GenePrediction:GLEAN_3838 Details

Name: GLEAN_3838
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1213618..1216014 (+ strand)
Length: 2397
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1213618..1213682 (+ strand)
Length: 65
Type: CDS
Source: GLEAN
Position: GCSC_113:1213736..1213883 (+ strand)
Length: 148
Type: CDS
Source: GLEAN
Position: GCSC_113:1213946..1214447 (+ strand)
Length: 502
Type: CDS
Source: GLEAN
Position: GCSC_113:1214509..1215446 (+ strand)
Length: 938
Type: CDS
Source: GLEAN
Position: GCSC_113:1215499..1216014 (+ strand)
Length: 516
>GLEAN_3838 class=GenePrediction position=GCSC_113:1213618..1216014 (+ strand)
ATGGATTCTCAGGATCAGCCGTCCGAGCAGAGGAAGCGCACGCGCCAGGCCTGTGAACCCTGCAGGTGTGTCTGGCCGTC
CCATGTGGACAGCACCTGATCGAATGTTGACATTGCAGGCGCAAGAAGGCCAAATGCACCGGCGAGCGGCCCGGCTGTAG
CACGTGTGGTCGATTGCGACAGCGGTGTTTTTACGCGGCCGACCCGCGTCCAATGGCGGACATGAGCGTGACGAGCGAGG
TCTCACGGTCAGAAGCCGAGACTTTGGTGCGTTGGTTGCTCCCCAGAGGTAAAGAACAGGCACTATCTAACACGAGGTCG
TCTTGCAGAGCACCCGCGTCCTCGCTCTCGAATCGACGCTCACAGAAGTGCTTGAAAGCCTACGACAGGGCACACACGGC
GGCCAGACGCAGGTGCAACCGTCCTCGCAGCCGCCATCCGATCGGAGCTCCCAACCACGAGAGACGACAGGCCTGACTGG
TTCATCGCGCCTTGCTGCTGCTGGTGGCGATCTGCTGCCGCCATGGCCAACAGTGCTCGCGGCTGCTCGCGACTACCTGC
AGTACTGTGACAGCCAACCGATCCCGCTCTTCGACCCAGAGAGCTTTGTGGAGACGCTGGCGGACCGCGACGAAGAGGTG
GTGTACGGCGTGCTGGCGCTTGCCGGGCATTTTGCGAGCAGCCCGTCAACGGACAAGGAACAACAAGAGCGGGACTGCAG
CGCATATGCGCAGGCAGCACACCGGCTGGTGATGGGACGTGTCAGCGAGAGCCGAGTAGAGCTGTCGACGATACAGACAT
TGTGCCTGCTGTCGTTGATCCGATTTTACGGTCAGTAGATGTGTGCAGGTGTCTCGGGAGTCCACCGGCCGACCGACTGA
CTTGGCTACAGACGGAGCGATCGACCAGAGCCGAGTGCACAGCTCGCTGGCGATGACGCTGGCGCACTGTGCAGGGCTGC
ACATCGAGGTCAACCGGCAAGACAGCCATGCGGCAGCCGAGGAGCGGCGACGCTGCTACTGGGGGGTCGTGCTGCTGCGG
CGACTGTTCGGCTGGGCGATCGAGGGGGCAGAGGACGACGGCAGCGGCAACAGGACGATTCGCGGCGGACAGCTGCCGCT
CTTTCCGACCAGTCCGTCGTCGCCGCTGTCCGAGAGGACGAACGGGGCTGGTTGTCGCCGGTGGACCGAGGCCGAGCGGC
TGGATGGCATCCTCAGCACAGTGATCCAGCTGGCCGAGGTGTGGTCGCTGGCGCAGGATTACGTGCGGACGCGAGGAGCA
TCTGGCGAGACGACGACGAGCTCGACAGCACCGCCGCCGTGGTCACCTCAGTCCAAGTATTCGCGGGCATTGCGACGGTT
GATGGACCTCGGTCAGGACCTACCGCCGCTGCATCGCAACCGATGCGTTCGGCTGGCAGACGTGACGGCCGACGACCTCG
CAGACAGGCGGGGACGCGCGTATTGGGCGCCTTGGTTCCTCAGCCACTTCCTCTACCACACGGCCATCTGTCTGCTCAAC
CACCCACTGCTGATGACGCTGCAGTTCCAGGACGGCCGCGGCTTCTCAGAGGTGTTTCTGCAGCAGACAGCCCATCTGGC
GGCCTACCACAGCTCGTGGCTGCTGCACTTTGTGCACTTCTTTGACACGCGTCGGTTTGCCGTGTCCGATCCGCTCTTTG
GCTATTGCACGGCCGTGGTGGCCACGATTGAGCTGCAGCACAGCTTCTCGGACGATCGAGCGCTGCGGCACAAGGCTCGC
GTCAACTACGACCACTGTCTCGCCTTTTTGCGGAGGCTTTCGCGCGACTGGCCTTGCGTGCGCCGTCTGGTGAGTTTGGA
CCGTCTTTCTTCCTTCAGTGCCGGATGCTGACTGCGGACAGACACAGAAGCTGGACGCGCTGGCCGACCAGATGGTGCGC
CACGACACCAACGACTCGACGCTGACGGTCAACATCTCCGGCTTCCTCGACATGCTCGATCTGGCCAGCTCGTCTCGCGT
GCACGGGTCGTCCATTTTTGGGGCGAGTCTGTCGCTGCACGTGACACACGAAGAAGCGGCGACATCAGACCCGACGCCCC
TCTCGCGCCTGCCAGCCATCACGACGATGGACCCAGCCAAGGCCACAGGGCGGGACGAACAGGCAGGAGGCGGTGTCGCG
GCTGTCTCGGCGGCCGACACACGGTCTCTGGTGCAGGCGAGCCCACTTCCCCTGGACGGTGGCAGTGGCAGCGGTGGAGA
CATGTTCCTCCCTGCGGATCAGCTTCTCGGTGGCCACCTGCAGGATGTGAATGCCTGGTGGAGCGGGACCTGGGGCGATG
CGGCTGGAAGCTGGGCGCCAACCGGCTTTGGCCGGAGTGCCTGGCCCCTGGACGGAAACGAGCCGTACCCACCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62