GenePrediction:GLEAN_3840 Details

Name: GLEAN_3840
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1218982..1220475 (+ strand)
Length: 1494
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1218982..1219302 (+ strand)
Length: 321
Type: CDS
Source: GLEAN
Position: GCSC_113:1219375..1220475 (+ strand)
Length: 1101
>GLEAN_3840 class=GenePrediction position=GCSC_113:1218982..1220475 (+ strand)
ATGTCTCCACACGCCGTCCTTGAGCCGGTGTCGTGCAAAGCGGATGCAGACGACTTTGCGGCCTTTGGCGTGTCTGGGAA
CGCATTTCTGCCGTCCAGTCCGCCGATTGACCTGTTGCCAGACCCATACTACCAGCCATGGGAGCAGCTGGCCGCCCGGC
TGCCGGCACTCATCCAGAGCAGCACGCTCCGAGACGAGGTCCAGCAGCTTCCCCTTCTCCATACGGACGGCCTTGTCAGC
GAGCCCGAGCGCCGACGGGCATACTCCATCCTCGCCTTTCTCGCCCACGGCTACATCTGGGGTGGTAGCCAGCCGGCAGA
GGTAAGCGGAGCAGTAGCACAGTGTATACACTGTGTGTATAATGTCCTTATACTGTGACGCTGACACTGCCAGATCCTTC
CACCGAGCCTGGCCGTGCCACTGCTGGCCGTATCGAAGCAGATAGAGCTTCCACCGGTAGCGACGTACGCGGCACTGAAC
CTGTGGAACTACGGCACGCGCTCGTCCGCAGGCGACCTGGACCTGGACGGCCTGTCGGCGCAGCGGACCTTTACGGGCAC
CGTGTCCGAGTCGTGGTTCTACATGGTGTCGGTAGCGATGGAGGCTGAGGGCAGGCGAATGATTCCGGCGGTGCTGCGGG
CACTGCGAGCGATCCGGATGCGAGACGAAGGGGCGGATGGGGCGCGGGCAGCGTACACGGCGACAACGGCAGCATTCGAG
GCCGTGGCAGCGTGCGTGCGACAGCTGTCGGTCCTGCTGGCCCGCATGCATGAGCACTGCGATCCGGAGACGTTCTATCA
CCAGATCCGGCCCTTTCTGGCCGGTAGCCTGGGTATGGCACACGCCGGGCTGCCGCGCGGCGTCTTCTACGACGAGGGCG
ACGGCCGGGGCGTCTGGCGACAGCTTCGTGGCGGCAGCAACGGCCAGAGCAGCCTGATCCAGTTCGTCGACATTGCGCTG
GGCGTGCAACATGCTCGGGGGGGCCACAGCTCGCCTCACGTGGCCTCGGCAACAACAACAACAGACGGTGTCGCGGCAGA
CCAGCAGCCCAGCTTCCACGAGGAGGTGCGCGACTACATGCCCGGGCCCCATCGTCGCTTCCTCGAGGCCGTCCAGCACA
TGGGCAGCCTGCGAACGTTTGCGCTGGGGAATGGCGGCACGGAAGACGTGGAGGATCAAGAGGACAGCTCAGACACCATC
CCTCGCCTGCAACGCCGCTGTCGCGCTGCCTATCACGACGCCGTCGACGCCATGACGGCCATGCGCGATGGCCACCTGCA
GATCGTCGCCCGCTACATCGTGCTGCCCAGCCGGAAGCCGTGGACTGGCGCGGCCGAGAACGTCAACCTGGCCAGCGCGT
CCAGCCGCCGGAGCGCGACCGACAGCACAGCCGGCAGTGATGAGAGGCTCACCGGCACCGGCGGCACCGAGCTCATGCCG
TTTTTACGCAAATCCCGCGACGAGACCGTGGCAGCTCGGACGTGCTCGTGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62