GenePrediction:GLEAN_3841 Details

Name: GLEAN_3841
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1221129..1225164 (+ strand)
Length: 4036
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1221129..1221682 (+ strand)
Length: 554
Type: CDS
Source: GLEAN
Position: GCSC_113:1221831..1222776 (+ strand)
Length: 946
Type: CDS
Source: GLEAN
Position: GCSC_113:1222827..1222934 (+ strand)
Length: 108
Type: CDS
Source: GLEAN
Position: GCSC_113:1223466..1223602 (+ strand)
Length: 137
Type: CDS
Source: GLEAN
Position: GCSC_113:1223686..1224105 (+ strand)
Length: 420
Type: CDS
Source: GLEAN
Position: GCSC_113:1224177..1225164 (+ strand)
Length: 988
>GLEAN_3841 class=GenePrediction position=GCSC_113:1221129..1225164 (+ strand)
ATGGCAAGCTCGGAAGATGACGCCATTCCCGGAACAGAGATCGTCTACCGACCCGGACAGCATGGCGGACCAGACGCAGA
TCACATAGACCTGGTCCTCATTCCTCAGCCCTCTTCAACCGCTGCTGATAACCCGCTCAACTGGACTACCCCCTGGAAGA
CTCTGGTCCTCGCCAGCCAGTTTGTCTTTGTCTTTGTCTCCATCATGACCCCGCTGGCTATTGCCCCTCTCACCCACTTC
TTCATGCTGCAGTTTGACAAGACCCTGCCGCAGGCCAATCTGCTCTTTGGCGTCGCCGCCATCACCCTGGGCTTTGCCAA
CTTCCTCATCGTTCCTGCCGCCAACGTCTTTGGCCGCAGACCCATCGTCGCCATCTGCGGCATCATCTGCCTCCTGGCCA
ATGTCTGGCAGGCCCTCGTCACCAGCTTTCCCAGCTTCATCGGCGCCCGCGTCATCTCCGGCCTCGGGGCTGCCGCCAAC
GAATCCATCATGCCAATGGTCGTCGCCGACATCTTGTTCCTGCACCAGCGCGGCCAGTCCATGGCCCTGTACTTGTGAGC
GAGCTCTGTCTCTCTGTGCCGGCCTCGAGACTGACCCTTGCCGCTCCAAGCTGGGCTTACTTTCTTGGTCTCTTCTTCGG
TCCCATCATCGCTGGAAGCATCGGCGCTCGCATCAGCTGGCGCTGGTTCGTACGTAGTCCAGTCCCCAGACGCTGTGGCC
CGTCATTGACCAGGCCATCTTCCAGTTTTGGGTATGCACCATCCTGCAGGGCGTCTCGCTCATCTTCATTGTCGTCGCCT
TTCCAGAAACGAAATATGTCCGCCCTGTCGACCCTGTAGAGAACATGGGCGAACAAAGAATCAGATCTGGCACCACCAAC
GCCACAGTCTCGGACTTGACAGAAAAGGCAGCCCCCGTGCCCCATATATCCTCAGCCGACGTCGAGACCGGTCAGCCTGT
ATGGGACGTTGCCGCCGATGCTATCGTGGCGATAGATGCTGATGCTGCTGCTGCTGTTGTTGAGATCGTTCCAGATCGTA
GCAACCCCCTCGTCGGCCGCGGTCGCCCGGCACGCTGGCAGTGGTCACTTGTGCCGAAGCCTCGCTTCGACCACGGCCTA
GCATTGGTTGTTCGCGACCTTGTCTCCCCAATACAGCTGTTTCTCATCTATCCCATCGTCCTCTGGGCATCACTTGCCAT
GGGCTTCGCAGCAAACTCGCTGCTAGCACTCAACCTGACGCAGGCCCAAGTCTTCCTCGCACCTCCCTACAATTTCTCGG
CCGACCAGGTTGGCTATGTCAACTTCTCCTTCGCTGTCGGTGCTGCTATCGCACTGCTGACCGCTGGCCCGTTGTCTGAC
TGGATAGCACTGCGAGCAGCTCGACGCAACAGCGGCGTCCTCGAGGCAGAGATGCGGCTGCAGGCACTGATACCGTTCAT
TGTCGTGAACCTGGTCGGCATGGTCGTGACTGCCGTCGGGTACCAGCGAGGCTGGGACTGGGCTATCACCGTGGTCGTCG
GCTATGGCCTTGTCGGTATGCAGGTTGTCGGCATCCCGGCCATCGTGATCGCGTATGCTGTTGACTGCTACAAACATCTT
CCAGGCGAAATCATGATCGCGGCCACGATTGTGAAGAATACCTTTGGCGTAAGCCCTCTCTCCCTGAGCTGTGGATGAAC
GTGGCCTGACAGTTGCAGTTCGGCATGATTTTCTATTACAACGACTGGACCGCGCGGGGGGGATATCTTGCTCCTGTTCT
GATGCTCATGGCTATCACTGTCGGCTTATCTGTCCTCGGACTTGCTGTATTTATGCCCTTTGGCAAAGCGCTGCGGCGGT
GGACGAGAGACTCAAAGATGCACACGCTGTGATGTTGTTGCGCCATGACGAAGATAGGGCCGGTGCTGTTGGGACTTGTG
TACATAGCGAACATAGCGTCGGCCATTCTCCAATTGCTATTTTGGATCCAGTCCAGCAACGGCCAACGTCGGCCGACTGC
CGCACCCGCCGCTTATCGCCTTGTTCGCTATTTTGGCTGTCAGCTAGCTTTATCTCGGCTGCCCTATCTGACGGCAGCCT
CCACACGAGGACCCTCGACTGCCCTTTAGGTTTGGCTGTATTTCGCGGTACTTCATGGCGCCATTTCCTTTCTTCCCTTC
TTATCGGGGCTTCCTCCTTTTTGCGCGTTTTCGGTAACTTGCTTCTGTGCTTCCAGGTCGTCTTTCTGTCTAGCGATGTT
AGACCTCATTATCCGAAACGGCCGGATTGTAAGAAGCCGCCCACCCGCGGGATGATTTGCAAAAGTTGCATGGTCTCTAA
CAAAGTGCTCTTAATAGGTCACCGCGGCAGAGGTGCTTCCCCTGGGCCTCGAGATCGGCGTCAAGAATGGCAAGATCGCC
ATGATCGGCCATGGTCTGGAGGCAGGCAGCCAGACGGAGATTGTGGATGCCGAGGGCGCCTATATCACACCAGGGTAGGT
GTCCAGGTGGACGGACGTCTGCTCACTTTTAGCTGCCATTTTGATGCTGACGCACATCTGCCTCTCCCCCGACACAGCGG
TGTCGACTCTCATGCGCATATCGAGCAGGACAATGCACCCACGGGTGACACTTGGGAGACCGGATCTCGGTCAGCGCTCG
CTGGTGGTAACACGACGGTGCTTGCATTCGCGTCGCAGAAGCGGGCCGAGGAGAGCATTTGGCCAGCCGTGGAAGCGTAT
CACGCCAAGGCCAAGGGCAACTCGTACTGCGACTATGGCTTCCACGTGATCCTAACGAATGCCAACGAAGAGGTGCTAGA
GAGAGAGCTTCCGGCGCTGCCTGAGCACGGAATCACTAGTATCAAGCTGTATATGACGTACCGGCCGCTCAAGCTGGACG
ATGGGTCGCTGTTCAGCATCATGATGGCAGCGCGGTCCCTCGGCATCACGATCATGATCCACGCCGAAAACAACGACATT
GTGGAGCAGATCACCGCGTGGGTATTCCCTGTCGGAGTGCTGTGGTGGCTGCTGATTGCCAACTGCTGACCGACATCTTC
CCTTCCAGGCGCCTCGTCAAGAAAGGCAACACGCAGACCTATTTCCATTCTGTCGCGCGGCCCCAGATTGCCGAGAGTGA
GGCAACGTACCGGGCCATCAGTCTGGCCGAAGTGACAGACGCGCCGATCCTCATTGTGCACATGTCGTCACCGACAGCAT
TGCGACACGTCCGCGAGGCGCAAAACCGGCTTCTGCCCGTGCACGCCGAAACCTGTCCGCACTACCTGTACCTGACGAGC
GACAAGCTGCGCTCGGAGCCGCATCCGCCGCACGACTTTGACGGCGCACGGCACATCTGCGCGCCGCCACTGCGTCACAG
TGCACAAGACCTCGAGCAGCTGTGGCAGGAGCTGGCCAACGGCACGTACACGGTCGTGTCATCGGACCATGCGCCCAGCC
TGTTCGACGATCCCAATGGCAAGAAGCGCGGACTCACGGTCGACGCCAAAACGGGCGCCACCCATGTCGATTTTCGCACC
GTGCCCAACGGGCTGCCCGGTATTGAGACCCGGCTGCCGCTGCTGTTCCACCGCACGTTCGATCCGGCTCTGGGCCCGCC
GGCCGGCAACGCTGCCGTACACATCTCGCTCCCGCGCTTTGTCGCCCTGACGTCGACCAACCCGGCGCAGCTGTACGGCC
TGGCCGACTGCAAGGGCAGCCTGCAGCCGGGTCTGGATGCCGACATTGTCATCTGGTACCCCGAAGCAGTGCCGGGCGCA
GACGGACAGCCATCGCAGCCGCCCGCCTTTTCCATCACAAACGACTCGCTGCACCACCGCATCGACTACACGCCCTTTGA
AGGCATGGCCGTGCGCAATTGGCCGCGGTATGTGTTCCTGCGCGGAAACCGGGCTTGGGATCGTGATAACGGCGGCGTGC
TGGCCTCCAAGGGCGATGGATGGTTCTTGAAACGCAACCGCTCGCGCATCCTGACTGGCCAGATGGGGCGTACGGCAACG
GGCATGAGCAGTGGCGAGTGGGCATCGTGGATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62