GenePrediction:GLEAN_3842 Details

Name: GLEAN_3842
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1226111..1228408 (+ strand)
Length: 2298
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1226111..1226190 (+ strand)
Length: 80
Type: CDS
Source: GLEAN
Position: GCSC_113:1226269..1226465 (+ strand)
Length: 197
Type: CDS
Source: GLEAN
Position: GCSC_113:1226520..1227079 (+ strand)
Length: 560
Type: CDS
Source: GLEAN
Position: GCSC_113:1227124..1228234 (+ strand)
Length: 1111
Type: CDS
Source: GLEAN
Position: GCSC_113:1228302..1228408 (+ strand)
Length: 107
>GLEAN_3842 class=GenePrediction position=GCSC_113:1226111..1228408 (+ strand)
ATGGCGCCCCCACGAGCTAGCGGTCCTCGGCGCTCACAGCTGCCGAACGAGCACATCTACACCTTGGGAGAGCGTGGCCG
GTAAGCGAGAAGACAGACGGGGAAGGGAGGAGAAAAAACAAGAGGCGAGAGACCCGCTCTCAGGCTGACAAACGGCAGCA
AAACCGGCGTGACCCTGCGCGACACGGGCGTGCGTGATGAGCATGGCATGGAGCCCATGGAGAGCATCTTCTCGTCGCCG
GCAAAGTCGTCTCCAGGCGATGCGCTCGATGCTTCTGGGGACGAGCAGGTGGAAGAAGACGGCGGGGAGGAGGACGACGA
CGATGGCGGTGAGGTGGACATGGACCTGACGACTGGTGAGAGCGAGCCTTGTACCTTCCATCCGGTTTCCCTCTGCTGAC
AGTCAACAGTCGCTGGACCAGGCCCGGCGGCTCTGCTTAACGGCCAGAACACGGCAGCCCGTCTGGCGATGCGGCAAGCA
CGCTCGCCTGCCGCTTCCAGGTCGCTCTTCGGGTCGCCAGCTGTGCGTGCGGGCCTCAATAACAAGGGGGTAGCGGCGGC
AGCAGGTGACCAGAAGCCGAAACACGGCGCGCTGCGCCAGAATCAGCTGCTGCGGCCACCGTCGTCTCCCGACGCTGCAA
ATGCGCCCCCATCGAGCCCGGTCAAGCCGGTCAAGAGACGGCTCGACTTTGGTAAGCCGGTGTCGGCAAATGCGCTGCGC
AAGCCCGTGCTTCTGCCGGCTGCGGCCAGACGGGTAGAAGAGGAGGACGACGACGAGGAGAGCATCCTACACGGGACTCC
TGACAACGGGGCAGATGACTCGATGCAGATGATTGACGGGCCAAACGAGTTTGCCGACGACGAGCCCGAGGAGCAAGACG
AGCCTAGCGTGCATGAAGACGTCGCCGAAGAAGAAGAGCCGGTGCTGCCGACAAAAAAGCGCGGTAGACCACCGGCGAAG
AAGACTGCGGTCAAGGAGGTTGCGGAGCACAGGCTGCGGCTAACGGTACGAAGCGACGTCGACCTGGTCGGCCATCCAAC
GCCAGCAACGACGTGCCATCACCACCGCCATCTCCACCGCCTCACGACGATGAAGCAGACGAAGAGCAGGGCAGCGCAAA
GAGGCAGCGCAAAGAGGCAAAACCAAAAGGTCGGCCAAGAGGGCGGCCGGCAGCAAACAGGCCGGTGGTTGAGGAAGCGG
CCGATGAGGGTCAGTCGGGCGAGGCGAGCCAGGCAGGCAAGCGGATGACGAAGAAGAAAGCAGTGCCGGTAGAAGCAGCG
ACCGGGCCGGCGCCCAAGAAGAGGGGCCGGGGCCGCAAGTCGTCTGGTGTCGGAGCGGCGATGGCGGCAGCAGCAGCGGT
GCCTCGAGGGCCGCCACTACCCAAGAGCCGGGGATTGGTGATTCGGCGGCGGGAGAACGAGGAGGACGGGGCGATGAAGC
GGACGCGGTCGGGGCGGACGTCGTACCAGCCGCTGGCCTTTTGGCGCAACGAGCACGCCGAGTTCGAGACGAGCGAGGTG
GCGGACTCGACGTGGCGAGATGCCCAAAAGGGCACCGGCCGACGCATCGTGCTGCCGGCGATGCGCGAGATCTACCGCGT
GGAGGAGGAGAACCTGCCACCGCTGGGAGGAACGGGTCGACGAGGTGGTGGTGGTGGCAGCAGCAGCCAGCGGCGACACA
GACGAGGTGGTGCAAAGCGACGGGGCGACGGCGACGACGACGACGATGACGATGGCGACAACAACAGCGGCGGCCCCGAG
CGACAGGCGTGGGAGTACGATCCCGGACGGGTGCAGGGCAAGGTGGCGTTGTGGCGGCCGGAGCACGAGCTGGAGCCACC
GGGACCGGACGAGGTGTTGGAGCAGGCCGAGTCGGAGATTGCGCTGTCGGCACTGGCAATCCAGACGCAAGACGTACGCG
ATGGCAGCTTCCGGTTCGCCAAGACACTCAGCCTGCCGTTCTTTGGCACCGGCGTGGTCGACCTGGCGCCCGGTGCGGAG
AAGCGGCCTAAGAACTCGCGCAAGATGCACATGGCCTTTTTTGTCCACTACGGCCACGTCGCCGTCACGGTCAACGAGAC
CGAGTTCCGCATCGCCAAGGGCGGCATGTGGTCTGTTCCACGAGGTCGGTTGGCTCGTCCGAGGCGATGGATCCGTCTGG
CTTTGGCACAACGTCCCGCTAACTTGTCCAGGAAACTACTACAGCATCGTCAACGATACCGACCGGCCCGCCCGCATCTT
CTTCTCGCAGGGCTGCGAGATGCTGACCGTGCTGGAGCCGGACGCCGAAGAGGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62