GenePrediction:GLEAN_3846 Details

Name: GLEAN_3846
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1265407..1266605 (+ strand)
Length: 1199
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1265407..1265418 (+ strand)
Length: 12
Type: CDS
Source: GLEAN
Position: GCSC_113:1265487..1265579 (+ strand)
Length: 93
Type: CDS
Source: GLEAN
Position: GCSC_113:1265650..1266485 (+ strand)
Length: 836
Type: CDS
Source: GLEAN
Position: GCSC_113:1266578..1266605 (+ strand)
Length: 28
>GLEAN_3846 class=GenePrediction position=GCSC_113:1265407..1266605 (+ strand)
ATGGCCATCGCTGTAAGCTGTTCTGTGCGCCGACGGGAAGAGAGCGATGCGGTGACTAAGACTGGATTCGATTTCGCCAG
GCCATTGGTCAGATCTGCTCGACGGCCTCCATGGCCCATAACCTGGAGCAGTGCGTGAGCCTCGTCCACCGAGCAGCCGC
AGCAGGGGCCAAGGTGGGACAGGACCCCAGCGGAGACGACTGTGGTGTGTGGGCGGTCTCGCACTGACACGGACACGGCG
CAGGTGCTCTTCCTGCCGGAAGCGTCCGACTACGTTGCCGCCTCGCCGGCCGAGTCGCTGCAGCTGGCCCAGCCGGTGCG
GCAGTCGCCCTTTGTGCGCGGCCTGCAGGCGGCGGCGCAGCAGCACGGCATTGCCGTCCATGTGGGCGTGCACGTGCCCG
TGACGGTGCGGGCGGCCACGACGGTGACAAGCACCGTGGCGCCGACCGTGATCGATCCAGCGGCCCATACGAAGAAGCTG
CTCAACCGAGCCATCTGGATCGACGAGGCCGGCCAGCTCGACGACGACGACGCGGCCGCCTACGACAAGCTGCACCTGTT
CGACTATGCCGGCGCGGGCCTGCGCGAGAGCGCCCACACACAGGCTGGCACGCAGCTGCGGTCACCTCGCGAGACAGCCA
TCGGCCGCGTCGGCAGCCTCATCTGCTTCGACCTGCGCTTTCCCGAGGTCGCGCTGGCACTCGGGCAGCCAGGTAGCAGC
AGCATCCCCCACCTCCCTGCGCACATCATCGTGTATCCTTCCGCCTTCACAGTCCCGACCGGTCGGGCACACTGGGAAGT
GCTGTTGCGCGCGCGGGCCATCGAGAGCCAGTGCTACGTCGTGGCGGCGGCACAGGTCGGACGGCACAACGAGCGGCGGG
TCAGCTACGGACGCAGTCTCGCGGTCGACCCTTGGGGGCGCGTGCTCTGCCGGCTGGGCGGCGTGGTTAATGGCGAGGCC
GAGGACGGGTCCGAGCCGGGCGATGCTGAGGACGGCGCCGTCGGACAGCTCGGACTCGTCGACATTGACCTCGCGGCGTG
GGCCAGCATACGCGAGAAAATGCCGTTGGTTCGGCGGACGTGAGTGATTTTGTCTTTTTGTCTTTCTGTCCTCTTTGTCT
TCTTCTTCTCCTTCTTCTCACACTTCTCCTCTCTCATGCTAACACGCACAGGGACGTCTACCCGGAAATCACATATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62