GenePrediction:GLEAN_3848 Details

Name: GLEAN_3848
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1279575..1280821 (+ strand)
Length: 1247
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1279575..1280538 (+ strand)
Length: 964
Type: CDS
Source: GLEAN
Position: GCSC_113:1280595..1280821 (+ strand)
Length: 227
>GLEAN_3848 class=GenePrediction position=GCSC_113:1279575..1280821 (+ strand)
ATGCAGGATAGAGCAAGCTTTGTCAGCAAGTCAATCTTCCGTCATCAACCCGAGATGCTGGCTGCTCTCGCAGATCCGGG
TCCACATCTATACGACGAGGTTGAAGGCACCCCCTTCCAGGGCACCGTGTCCTTTGCACATCTTGAAACTCCCGACTGCT
TTTCAGCTGCCGAGGATGGCATTTTTGACATTGCCATTGTCGGCGCCCCTTTTGACCTGGGCGTTACATACCGGCCTGGC
GCTCGATTCGGGCCCGCTGGAGCTAGGATGGGCTCTAGGCGAATAGCGCCTTCGGTGGGCTACAGGTACGTCGTATGCAG
GGCGTCAGGTCCTCCCTTGCGCACCCCTATAGCTGTTCGACGGGGCTACCAAGTGCTGACGGCCAGCATGGACAATGGCG
TGAATCCCTTCCGGGACTGGGCCAAGGTGGTCGACTGCGGCGACGTGAGCAACTCGCCTTTCGATAAGCTGCTGGCGATA
CACGAGCTCCAGAAGGGCTGGGAGGCTGTCGCGAGTCGCAAGGTGCGCAACCCTGATAACGGCACCGTGCCACGCATCAT
TGGCATCGGTGGCGATCACACAATCAGCCTACCGGCAATCCGCGCGCTGTCCAGGACATGGGGCCGCGTGGCCGTGCTGC
ACTTTGACTCCCACCTAGACAGCTGGGACCCAAAGCAGCTTGGCGGCGGCAAGACAAAGTACGCAGAAATTAACCATGGA
ACCATGTTTCACATCCTGCACGAGGAGGGCCTCTTGTCCAAAGATGCCAATATGCACCTTGGAGCGCGAACAATGCTGTT
CGATAAGTCGTACGACTTGGAAAACGACGCGCGGTGCGGCTTCTCGTACATTCGTGCCCGGGAGCTCGACGTTATGGGCG
TCGACAAGATCGTTGCAAAAGTTGTGGAGACAGTGGGCGACAGCTTTGTCTACTTGAGTCTCGACATCGACGTGCTTGAT
CCAGGTAAGCAACCGTCCCTGTGGCCCGGCTGAATGTCAGTGCACTGACTCCCGCACCAGCCTTTGCTCCGGCTACCGGA
ACAATCGAGCCGGGCGGGTGGACAGCGCGGGAGATGCTCCAGATCCTCGACGGACTATCTCAGGCCGGCGTCAAAATTGT
GGGTGCAGACGTTGTCGAGTTCACGCCTGTGTACGACAACTCGGCGGAGACCACCGGACTCATGGTTGCGCAGCTCGTCT
ATGAGATTCTCCAGTGGATGGTCCGGGTTCCTGTGTCCCCACAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62