GenePrediction:GLEAN_3849 Details

Name: GLEAN_3849
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1281476..1282722 (+ strand)
Length: 1247
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1281476..1282517 (+ strand)
Length: 1042
Type: CDS
Source: GLEAN
Position: GCSC_113:1282598..1282722 (+ strand)
Length: 125
>GLEAN_3849 class=GenePrediction position=GCSC_113:1281476..1282722 (+ strand)
ATGGCGCCTGTTGCCTCTAAGCCCGTCCCCGACGCCGACACGGCGGTGCCGCTCCCGGCAAACGACAGCGTGGCTCACGC
CATCGCGGGTGCGGGCGGGGGCATTCTGTCGACACTGGTGACATACCCGCTGATCACGCTCTCAACACGGGCACAAGTGG
AGTCGAAGCGCGCGGACTCGTCCTTCCTGGCGGCAGTGGAGCACATTGTAGCACGTGAGGGCGTGTCTGGTCTGTATGCA
GGCCTCAACTCTGCCGTCTTCGGCATCGGGGTGACCAATTTCGTCTACTACTACTGGTATGAGTGGACGCGGGCCGCATT
CGCACAGGCTGCCGCTGCACGTGCGGCCACACCAGGCCGGGTGGCCGGAAGACTGACGACGGCAGAGTCGATGATTGCGG
GCGCCGTCGCCGGTTCGGCCACGGTGATTCTGACGAACCCGATCTGGGTGGTGAACACGCGAATGACGACACGCCGACGG
CCATCGACAAAGAAGACTGCCTGCACCAGCGCCAGTGCTAGTGCCAGTGCCAGTGCCAGTGCCACCATCTCCAACCCGTC
GTCAGCAACATCCACGGCAACGACGGACGAGGAAGCCGTGCTAGTTGAGTCGGACAAGGAGAAGAAGGAAGCGACCAAGG
ACGTGGAAGCGGAAGCGGTAAAGGAGCCAGAGACAGCGGCCGTTGCTGCGCCCACGTCAACTATCGGCACCCTCTTGGCC
TTGCTTCGGGAGGAGGGCCCGCGGGCACTGTTTGCCGGTGTCGTGCCGGCGCTGGTGCTCGTGATCAACCCGATCCTGCA
GTACACCCTCTTTGAGCAGCTGAAGAATATGGTACAGGCGCGGAGAGCCCGCGGCGCGCCCTTCACACCCGGCCTGGCGT
TTATCCTGGGTGCCGTGAGCAAGCTGTTTGCTACCGGCATCACTTACCCATACATCACGGTCAAGAGCCGCATGCATGTG
GCCAAGGACCGCAGTCAGGGCGGCGTGACGGCTGTGCTGCGCCGCATCATCCAGGAGGAGGGCTACGCTGGTCTATACAA
GGGTGAGTTTTGCCGTACTCCTTGCGTCTCGTGTCATATCCGTCGAATTTCCCTGGTTTCGCCCGTGCTAACGGCTTCTC
AGGCATCGGTCCCAAGATCACGCAGAGCGTTCTGACGGCTGCCTTCCTCTTCGCCCTCAAGGACGTGCTGTATGCCCAGA
CTGTGCGGCTGCGGTCGGTGGCAGCTGCCAAGAGGATCCATGCTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62