GenePrediction:GLEAN_384 Details

Name: GLEAN_384
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1458161..1460531 (+ strand)
Length: 2371
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1458161..1458216 (+ strand)
Length: 56
Type: CDS
Source: GLEAN
Position: GCSC_167:1458300..1458434 (+ strand)
Length: 135
Type: CDS
Source: GLEAN
Position: GCSC_167:1458515..1460169 (+ strand)
Length: 1655
Type: CDS
Source: GLEAN
Position: GCSC_167:1460221..1460305 (+ strand)
Length: 85
Type: CDS
Source: GLEAN
Position: GCSC_167:1460363..1460531 (+ strand)
Length: 169
>GLEAN_384 class=GenePrediction position=GCSC_167:1458161..1460531 (+ strand)
ATGACGGGGGCAAGCTTGGCCACGCCGGGCGGTATCTCGGATCCGGCCCTGATCCAGTGAGTAGTCATTTCTTTCTTTGA
AGTCTGCGCGTGTGGTTTCGTATTGTCGTTGTTCCGTTTCGCTAATCTGTGATATGCAGGCTTGTGAACAAGCTTCAGGA
TGTTTTTGTGACGATCAACGTCAACAACCCGATCGACCTTCCACAGATTGTTGTTGTCGGCAGCCAGTCGAGTGGAAAAA
GCTCCGTCCTGGAAAACATTGTCGGTCGAGACTTGTAAGATTGTCCAGGCCAGAAGGAGAGAAAAGGAGGGATGGAGGTA
GTGTTTTAGCAGTACTGACAGATGGCCCAAACAGCCTGCCGCGAGGCTCCGGCATTGTGACCCGACGACCGCTCGTTCTG
CAGCTGATCAACCGGCCAGCACAATCGGGCACGAACGGGGTGTCGGAGGAGATTGCGAGCGGCACGGACAAGGCTGCCAA
CGCAGACGAATGGGGCGAGTTTCTCCACATTCCCGGACAGAAGTTTTACGACTTCCACCAGATCCGCGATGAGATCAACC
GCGAGACCGAGGCTAAAGTAGGCCGAAATGCGGGCATCTCGGCGGCACCAATCAACCTGCGGGTGTACTCGCCCAACGTG
CTCAACCTTACGCTGGTCGATCTTCCGGGCTTGACCAAGGTGCCGGTGGGCGACCAGCCGCGGGACATTGAGCGGCAGAT
CCGCGACATGGTGATGAAGTTCATCCAGAAGCCGAACGCAATCGTACTGGCGGTGACGGCGGCTAACCAGGATCTGGCCA
ACTCGGACGGCCTGAAGCTGGCACGCGAGGTCGACCCGGAGGGTCAGCGGACGATTGGTGTGCTGACCAAGGTCGATCTG
ATGGACGAGGGCACCGACGTGGTAGACATCCTGGCCGGGCGCATTATTCCGCTGCGGCTGGGGTATGTGCCGGTGGTTAA
CCGCGGACAGCGTGACATTGACAACAAGAAGCCGATCCTGATGTCGCTGGAGGCAGAGAAGAATTTTTTTGAGTCGCACA
AGGCGTACCGCAACAAGAGCTCGTACTGCGGCACGCCGTATCTGGCGCGCAAGCTGAACCTGATCCTGCTGATGCACATC
AAGCAGACGCTGCCGGACATCAAAGCGCGGATCGCTGGGTCGCTGCAGAAGTACTCGGCCGAGCTGGACAGCTTAGGGCC
GTCGATCCTTGGCAACAGCGCGAACATGGTGCTGAACATCATTACGGAGTTTACCAACGAGTGGCGGACGGTGCTGGACG
GCAACAACACGGAGCTGTCGAGCACGGAGCTGTCGGGCGGCGCGCGCATCAGCTTCGTGTTCCACGAGCTGTACTCGAAC
GGCATCAAAGCAATCGACCCGTTCGACCAGGTCAAGGACGTGGACATCCGCACGATTCTGTACAACTCGTCGGGCTCGTC
GCCGGCGCTGTTTGTGGGGACGACGGCGTTTGAGCTGATTGTGAAACAGCAGATCAAGCGGCTGGAGGAGCCGAGTCTGA
AGTGCATCTCGCTGGTGTACGACGAGCTGGTGCGCATCCTGACGCAGTCGCTGAGCAAGTCGATGTACCGGCGCTATCCA
GGGCTGAAGGAGAAGATCCACCAAGTGGTCATCTCGTTCTTCAAGAAGGCCATGGAGCCGACGAACAAGCTGGTGCGGGA
CCTGGTGGCGATGGAGTCTTGCTACATCAACACGGGGCACCCGGACTTTCTGAACGGCCACCGGGCGATGGCGATTGTCA
ACGAGCGGCACAACCCGCCGAAGCCGGTGCAGGTAGACCCGAAGACAGGCAAGCCGCTGCCGGCATCGGCAACACCGGTG
CGGGCGGCCAGCCCGACGCTGGCGGCCGACGACAAGGAGAGCGGTTTCTTCGGCAGCTTCTTTGCGGCCAAGAACAAGAA
GAAGGCGGCATCCATGGAGGCTCCACCGCCAACGCTCAAGGCCTCGGGCACGCTGTCGGAGCGGGAGAACATTGAGGTGG
AGGTGATCAGTAAGTGAAGGGAGAAGAGAGAAAGGGGGAGAACCAGCTAACACGATGCAGAACTGCTGATCCAGTCGTAC
TATAGCATTGTGAGGCGGACGATGATCGACATGGTGCCAAAGGCCATTATGTTGAACCTTGTGCAGTAGGTTTTTCTATT
TTTTCCCAATCCATCACCTTCTCTCTCCAACTAACCGGATAGATTCACAAAGGACGAGATGCAGCGCGAGCTGCTTGAAA
ACATGTACCGGACGGACGCGCTCGACGATCTGCTGAAGGAAAGCGACTACACGGTGCGCCGGAGAAAGGAGTGCCAGCAG
ATGGTGGACGCTCTGGGACGAGCAAACGAGGTCGTCTCGCAGGTCCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62