GenePrediction:GLEAN_3850 Details

Name: GLEAN_3850
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1290359..1293173 (+ strand)
Length: 2815
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1290359..1290841 (+ strand)
Length: 483
Type: CDS
Source: GLEAN
Position: GCSC_113:1290934..1292370 (+ strand)
Length: 1437
Type: CDS
Source: GLEAN
Position: GCSC_113:1292469..1293173 (+ strand)
Length: 705
>GLEAN_3850 class=GenePrediction position=GCSC_113:1290359..1293173 (+ strand)
ATGGCTTCACGGCCACGGCCGCGGCCTGCACACATTGTGGGTCCGACGCGCTGCGCTTACACGCCCAACGGAAGGCAGCT
GGTGACGGTCGGGGCCAATAACACGATCCGGCTGTACAAGACGGGATTCGACGGCGAGCCAGCGAATGTAGACGACTGCC
AGGAGCAGAACGTGGGCGTGGCGGCGACAGACGACTTTTTTGTTGTCGGTTCCGAGGACGGCACGGTCAGTCTGTACTCG
CTGGACACCAACAGCTTTGAGCGGTTCCTGGTGCGGACGTCGCTGCCGGTGCGCGACGTGGCCCTTTCAGCCGACGGACG
CTGGTGTGCAGTGGCCAGCGACGAGTTGACGGTGCGCGTGGTTGGCACCGAGGACAACACGGTGGTACGGCACCTGCGGG
CGCACAGCCGGCCGACCAAGCATGTGGCCTTTGATCCGCAGGGCCGCACCATCGCGCTAGCCTGCACCGACGGCATTATC
TACGTCTACTCGCTGACAGCTGAGGGCAGTGGCAGTGGCCGTGGCAGTGGCAGCGATCCCGAGCTTATTCGCAAGCTAGA
CGGCATCATCGGCAGAGCCTAGAGTCGGACGCGGAGGCGACGGCGCACATTGCCTGGCACCCAGATAGCCGCGCCTTTGC
CGTGGCCACGCCAACACGTGACATCCAGGTGGTCTCGCGCAACGACTGGGAGAGGCAGCGGGTCTTTTCGGGCGGCCACG
AGGGCGAGATCACGGCGCTGGCCTGGTCGCCCAATGGTGCCCTGCTGGCGTCGGCCGGTCGTGACGGCAAGATGCTCCTC
TGGGAGACGCGCACGCAGTCCGTCGTCGCACGACACGACTATGCTGGCGTCCAGGACATTGCCTGGCACCCGACCAACAA
TTTGGTCTCCTTCACCAACGGCGAGGGCGAGGTCTACATCTGTCCCGACTTTGTCGGCCCCCAGTACGCCGCCCTGCTGC
GTCTGCCCGTGCAGCCGAGCCCCTTCATCCACGACCCGGACAAGGCCGTGCCCAACGGTCACAACCGCAACCGCGGTCAC
GGACTGCTGGACGTGGATGCTGCCGTTGACTCGGGCGACGAGGGCCTGATGAGTGGTCTAGAAGGTGGCAGCATGGCCGG
GGGCGACGACGGGCTGGACGAAGACGATTTTGGCCTGGACGATGACGAAGACGACGGCTTTGTGGTGGACGATGACGGTG
CCGGATACACAGCAACAGCAACAGTAGAAGCGACGGCAATGGGCCGAAAGCGACCCCACGACGGCGATCCATACGACCTA
CAGCGGAGCGCGAAGCGGCCAGGAGGATCCGGTGCGACCAACGGGCGAAGAGGAGGCGCGGGCGCATCGTGGCCGCCGCG
GTACCACGCAGCCTTCCAGCCGGGATCGACACCATGGCGCGGAAACCGCAAGTATCTCTGCCTCAACCTCGTCGGCGTCG
TCTGGACGGTCGACCAGGACGCTCATCACACGGTGACGGTGGAATTTTACGACCGCGACTTCCAGCGCGATTACCACTTT
ACCGACACGTTCCTCTACGACAAAGCGTGTCTCAACGAGCATGGCACGCTCTTCTCGTGTCCACCGCGCGAGGACAGCAC
GGCCGGCCGGCGTGGTGGCACACCGGCCATGCTCTTCTACCGGCCGCACGAGAGCTGGACCCAGCAGCGGCTGGACTGGC
GGACGGCTCTGCCGGCGGGCGAAACGGTGGTGGCCATGTCCCTGAGCGCCTCATACGTGACTGTGGCGACGTCGGCTGAC
TACGTGCGCGTCTACACACTCTTTGGCGTGCCCTGCCGCGTGTTCCGACCCAAGAGCACACCCGTGGTCACGTGCGCCAG
CTGGCACGACTACGTCTTGACCATGGGCAACGGGCCTGCCGCGCCCGACGGCACCGCCCGGCTGCAGTACACGATTCAGA
ACGTGCAGCGCGATGAGATATGCCAGGACGACGACACGGTGGCCCTGCCAGCCGGCGTTACCGTGCAGTCCGTCTTCTTC
TCGGACGATGGGGTGAGTCGGTCCTTTCGGCAAGCTCGGATGTTCGGCGTGTTCGGCGTGTTCGGCGTGTTCGGCGTTCT
AGTTCGGATTAGCTAACCTTTTCGGTCCAGGACCCCTGCATCTACGATTCGACCGGCACCCTGCTGACGCTGCTGCACTG
GCGCCAGCCGTCGCGGGCGTCGTGGGTGCCGCTGCTCGACACCCGCCTACTGCCGCGCCTGGCCTCGGGCCGCAAGCACG
AGTCCTACTACCCCATCGCGGTGGCCGACCGCCGCTTCCACTGCATCATACTCAAGGGCGGCGACAAGTACCCGTACTTT
CCGCGGCCGCTGCTGTCCGAGTTTCCGTTCAGCGTCCCGCTGACGTCGGTGCCGGCGGGCGGGAAGAGGGGAGGGGGCGA
AGACGGTAACGAGGATGGCGAGGGCAGTGACGAAAACGATGACGAAAACGAAAACGACACTGAGCGCACCGAGGAGGCCG
AATCGCGGCGCCTCGAGCAGACGCTCGTGCTGCACAACCTGCACGCGGCCCAGATGGCATCTTCGTCGGCGGCATCGCCC
AGCTCGCTGGCGCGTCTGCACCTCGAGGCCGACAAGACGCTGCTGCAGCTACTGGCGTTGGAGTGTCGGGCCGGCGAGGA
GCGCGGCATGCGGGCGATGGACCTGGTGCGGCTGCTGCGCGACGGCAACGGCCACCTGATGGAGGCCGCCGTCAAGGTGG
CCGAGCGCTACGGCAGGGCGGTGCTGGGCAGCAAGATCCGCGAGGAGGCTGAGCGCCGGTTGGCGAGGCGAGTAGAGCTG
GAAGAGGACGAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62