GenePrediction:GLEAN_3851 Details

Name: GLEAN_3851
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1297255..1299402 (+ strand)
Length: 2148
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1297255..1297317 (+ strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_113:1297350..1297771 (+ strand)
Length: 422
Type: CDS
Source: GLEAN
Position: GCSC_113:1297841..1297939 (+ strand)
Length: 99
Type: CDS
Source: GLEAN
Position: GCSC_113:1298013..1298500 (+ strand)
Length: 488
Type: CDS
Source: GLEAN
Position: GCSC_113:1298561..1299402 (+ strand)
Length: 842
>GLEAN_3851 class=GenePrediction position=GCSC_113:1297255..1299402 (+ strand)
ATGAGGTTCGTCTGGACAGACAAAAAGGCTGCTGCTCTGGAGAATCGTGCAGCTGCAGTGCTCGTAAACTAACTCGTCAT
TCTTCGTCTTGACAGGAGATGACAGCCGCTACCGAATCCGCGTATCTGACTCGCATGACCGACGATCCTGAAGAGCCAAT
GACAGCACGAACAATTCCAATCATGACTCCTACAATCCAGATGTCTGCTCCCTCTCCGGGAGAACCGATGGATGTCACCA
CGCCGACAGACAGCTCGCCGCCGCCGCGGGCCGCTCCTTCGACGAGCAAGAGTCCCGACCGCAACACCGCTGCCCCGACT
GCTGCCGAAGTCCGCATTGGCACGGGTGCTTCCGTGTCCAACAGTCCGCCAACGGGGCCTTCAGAACCGGCCCTCAAGGC
GGAACAGCAACAGCCCCTTTCAGCTGGAGCTTCGGCGTCGTCAATACCAACTGCAGCAGCGCCGGCTGTCCACCAGCCCA
AGATCGTGCAGACAGCCTTTATTCACAAGCTTTACAAGTGAGCCCCAGTGTCTAGGAGCCCCCCCAACTGTCCGTGTCGG
GAGCTGACCAGTTGTCGCTGCTACAGCATGCTAGAGGATCCAAACATACAGCACCTAATTTCCTGGTCGGGCACCGCTGA
GAGTTTTGTCATGTCGCCGTCGCATGATTTCTCCAGAGTCCTTGCGTATGGCTTCCTCTACCTTTAATCTGCGTGGTGGC
GGGAGAGTTGTGCGTTGCATGTTCTGACATTGACCAAGCCAATACTTCAAACACACCAACATATCCTCGTTTGTTCGCCA
GCTGAACATGTACGGCTTCCACAAAGTGAGCGATGTCTTTGCCAACGGGTCCGACTCGACGACGCTGTGGGAGTTCAAGC
ACGGCAACGGGAACTTTAAGAGAGGCGATCTCGTCGGGCTGAGGGAGATCAAGCGCCGAGCCTCCCGCCACTCGCTGGTC
CATCGCGAATATAGCAGCCAGAAGCCGCCGCCGCCAACGTCACAGCCCGGCACGCCGGTCGAGTCAATGTCGATACCGGA
AGGCGGCGACCCGCGGATGAACATTGACCAGGCCATGTTCAACTTCGATGCCCGGCTGCAGCGCAACGAAGAAGCCATGC
ACTATATGCTCGTCAAGCACCAGGCAGCCATGGATGTGATCGCGCGGCTGCTGCACTTCAACCAGGAGCTGTCCCGCAAC
ATTTTGCACCTGGTTCCGAGCATGGACAATCCTGTTCATCGAGATGGTAGGAACCCTCTTGTTTCTCCACACACTCGTTG
TCCGTCTTCGTTTCTGACCGGACCAGTCGTTGCTTTGCAAAACGAGATGCAGAGACAGGCCGATATGCTGCGCTCCCTCG
ACGAGCCGCACGAGCCGCCCTTCTCCGGCAGCCGGCAGTTCTTCTCGGGCATGGACAACGCCCCGGTTTCGCCACGCCAA
ATGCCGCAGGACGACCCACGCCGGCCAAACACCCTGACGGTCCCGCAGCCACGATCAGCCAACAACTACTACCGGCCACC
TGTGCCGTCCAACCTGTCTATCAGCACCCGCCGGCCTTACGGATCGATTGGTGGCTCGACCACACAGTCGTCTCCGTCCC
GCACACACCTGCCCCCACCGCCTCCGATACCACCGCATACGCTGACGGCGATGGAGCCGCCCGCAAACAGCCTGGCACGG
CGGCACACGTCAGCAGACATCCGCGCGCATGGCTGGCAGGCAAACGCTCCGCATCTGAACCCGTTGGGACCAGGACCGCC
GCCGCCGCAGTCACAATACCCATCGTCGCCAAACCGGCTGGGACCCGAAGACCAGCGAATTCGCGAATCCTTTTCAGCTT
ACTCGCTTCAGGTGGCTTCCCAGCCGCACTCACGACCGGCAACACCGCCACCGCCACCGCCATTTAGCCAGAGCAATGGG
AACAGCAATGGGAACGGCAACGGGAATGGCAATGGGCCGGATCTGGGATGTTGGTCATGGGGGGCTGCCTTCAACCGAAA
TGGCAGCCTCGGCGTGAAGAATAGCTCGGCGCCTTCGACACGCCGAGGCAGTATGGCACACATCCTGAACCCGACAGACA
CAGCCGAACGCCCGGACGAGGATGGGAGCCCCCGAGACGAAGATCGGAAGCGGAAACGCATGATCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62