GenePrediction:GLEAN_3855 Details

Name: GLEAN_3855
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1317447..1319755 (+ strand)
Length: 2309
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1317447..1317597 (+ strand)
Length: 151
Type: CDS
Source: GLEAN
Position: GCSC_113:1317657..1319755 (+ strand)
Length: 2099
>GLEAN_3855 class=GenePrediction position=GCSC_113:1317447..1319755 (+ strand)
ATGGGTATTAAGGGAATCTACAAAGAGATTGGTGCCGGGAGGCGGATAGCCCTCCACCGGCTGGCTGTTGAGAGCCTCGA
GACTCGAGGCCGGCCATTACGGCTGGCAATTGACATTTCGATATGGCAGTTCCAGATCCAGGCAGCTCGGGGTGAGTTTT
CATGGTTCGTGTCCCCTATATTTTTCGTCTTGATCTGACGGTGCGTGCAGGCGGTGCAAACCCAGCGATCCGCACTCTGT
TCTACCGTCTCGTCCGGCTGCTCGGCATACCCATCCAGCCCATCTTCGTGTTCGATGGCCCGAACAAGCCGGCGTTCAAG
CGCAACAAGCGGTCGGCCAAGAGCGACGGCACGGCGACGGCCATGGCCAAGCGCCTGATCCGCCTTTTTGGCTTTATGGC
CCACGACGCGCCCGGCGAGGCCGAGGCCGAGTGCGCGCTCCTACAGCAGCGCGGCGTGGTCGATGCCGTCCTCAGCGAGG
ACGTCGACACGATCATGTTTGGCTGCACGCGCACGCTGCGCAACTGGTCGTCGGCCACGGCCACCACATCTCCGCCCACA
CACGTGTCCATGTACGAGACCGACAGCCTGCAACAAGACAAATCCGGCCTCGACCGCGAGGGCATGGTGCTGGTCGCCCT
GATGAGCGGCGGCGACTACCTGCCCGAGGGCATTCCCGGCTGCGGCGTCAAGCTGGCCTGCCAGGCGGCCAAAGCTGGGT
TCGGGCGGTCGCTGTGTCGGCTGAAACGATCAGACACATCGGCGCTGGCTAGTTGGCGCGCAAACCTGGTGCGCGAGCTT
CAGACCAACGAGAGCCGGTTCTTCCGAACGTGCCACCGCAAACTGCTCATCCCGGAGCAGTTTCCTAGCCTCGAGATTCT
GCGCTACTACACACACCCCGTCGTTTCGCCGGTTGAGATCGTCGAGCGGGTGCGGGCCGACCTCGAGGCAGTCGAGGCGG
CTGATCCTTTGGTCGTGATGCGGGAGAGACGGGTCGACATCCCGGGGCTGCGCGACTTTGTGGGCGAAACGTTTGACTGG
ACCGACCGAGCCGGCGCGATCAAGTTCATCCGCGTGTTGGCGCCCAGCCTCCTTTCCCGGATACTGCTCTTGCGATGGTC
TACGGACGACGGGGCAGAGGACGGGTGGCCGTCTGTGGTAAAGGGCATCTCCAAGCAACGGACGCACGCCAGCACGGACG
ACACACCCGAGTTGAGAGTATCGTTCATCCCTGCCACCGTGGTCAGTCTTGACCTGGAAGCCGAGAATGACGCGCCTGCT
GTCGCCTTTGGACGAGACGGGCTCGCTCTGAACAGCGATAGCGATTTCGCCGAGCCATCACCCGAAGAAGCTCACACGAC
TGGTGCCAGGAAGGCATCTGCCTACGATCCGACGCAAGCGGACGTTGCCTGGGTAACGAGAGCCGTTGTCGAGATTGGGG
CGCCTCGAGCGGTGGAAGCATGGGAGAAGGGACAGAAGCCGAAGGCTGGCACCAAACGGACCAAAGAAAAAGCAGCAAAC
ATCAAGAAAAAGACAGCGGCCGTGCCCAGCATGCCGACCGGCTCTCTCGATCGCTACGTGCAGGTGACAAAGAACGCAGG
TAGAGACACGGCGGCAGTACAGGGCACTCTAGACGATAGCGAAGCCGACTCGGAGTCCGTCCAGCCACAGACAGCAAGAC
GGCTAGAGGAGCGGACAAGACTACGGCGCCAGCCACCGGTCGCAAACCCGTGGTCGCTGGCCGGTTCACAGGCGCCTCGG
ATCACGAAGTCAGCCGTCCGCGAGCCGCTGCGAGACTGCTCGAAGGTGAGCAGTGTGTCACCACCCAAACCCACCAGCTC
TGTTGCAGCTGTCGTGGTGGACCTGCTATCGAGCCCGGAAGAGCCGAGGCTGCAATCGCTGGCCAAGACGAGGCGAAGCC
GTGCAGCTGCGAGCCCAACAAGAAGTCCGAGAAAGACGGGAGTACGGAAGACAGAGGTAACGACAGAAAACAGCCAGGTG
ACAAGACCTCCGCGACAAAAGTCGATCCGCGACTTTTTGTCGCAGCCGGTGACCGTGGCCTTATCATCAGACGAAGAAGA
TGGGGTGGAAAAAGAGGCTGGAGGACGGGCAAGTGAGACAGGCGAGCGATCAGTGCCACCTGCCAAGTTAAAGACGGTGT
ACGTCCCCCGTCGGAGCGCAGTAGGCTACTTTCGCGAGGAGACGGTGGAGGAGGATGGGGCGGACGAGAAGACGACAGGG
CATGCAAGACGAGGCTGGCGGAAGAGCGAAGTCAGCATAGTAGACCTCACGGGTTTAGACAGCGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62