GenePrediction:GLEAN_3857 Details

Name: GLEAN_3857
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1325685..1327230 (+ strand)
Length: 1546
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1325685..1325945 (+ strand)
Length: 261
Type: CDS
Source: GLEAN
Position: GCSC_113:1326028..1326202 (+ strand)
Length: 175
Type: CDS
Source: GLEAN
Position: GCSC_113:1326254..1327071 (+ strand)
Length: 818
Type: CDS
Source: GLEAN
Position: GCSC_113:1327135..1327230 (+ strand)
Length: 96
>GLEAN_3857 class=GenePrediction position=GCSC_113:1325685..1327230 (+ strand)
ATGATCTCGAGATCCGCCGTCTCAAGAGCAGGCCAGCTGGCCCTCCGGCGGCAGCAGGCCTGCGTCCGGACACAGACCCG
TGCCTTTGCTGCCGCCGCTTCCGGCCCCTCGGCCTTTGAGCCGACCGACATCGCCGGCGTCAAAGTCCTGTCCAAGGATG
GCCAGGGCCCCTCCACAAAGCTCGCAGTCGTCGCCAAGGCCGGCACCCGGTACCAGTCTGCGCCCGGCCTGACCGCCGGC
CTTGAGGGATTTGCTTTCAAGGTGAGCGCGCCCGAACCCGGACCGTCAAACCGTCAAAACGGCCAATGCGGCATCCATCG
CCTGCTGACCTCAAACGCCACAGAACACCTCGAAGCGCTCGGCTCTGCGGATCACGCGCGAGAGCGAGCTTCTCGGCGGC
CAATTGACCGCATACCACACTCGCGAAGCTGTCGTGCTCGAAGCCAGCTTCCTCCGCGAACACCTGCCGTACTTTACCGA
GCTGCTCAGCGAGGTTGTCTCGCTGACCAAGTTTACCAGTAAGGCTTTTCTCTCTCTCTCTTTCTCTCTCCCTCTTCTAA
CCGCCACAGGACACGAGCTGGAAGAGGACATTGAGCCGGTTCTGCACATCCAGCAGGAAAAGTACTCGGCCAACGCCCTC
GCCCGCGCCGTCGACGGAGCCCACGATGCTGCCTTCCACTCTGGACTCGGCCAGGCCCTCTACCAGAGCACCGCAACCCA
CGTCAGCGAGCACGATGTCGCCGCCTTTGCCGACGTTGCCTACACCCGTCCCAACATTGCCGTCGTGGCCGATGGCGCCA
CTCAGACCGCCCTCGCCAAGTGGGTCGAGCCCTTCTTCAAGACGGTCCCGGCTGCACCCAAGAGCGCTGCCGCCTTGAGC
ACTGCCGCCTCCAAGTACTACGGTGGCCAGCTGCGCGCCGACTCCGCTGCCGGCAACGCCGTCGTCATCGCCTTCTTTAC
CGCCGGTCTCAACGCTGCTGACCCCGCTGCCGCCGTGTTGGCCTCCCTGCTGGGCGGCAAGTCCAGCATCAAGTGGGCTC
CCGGCTTCTCTCTCTTGTCCAAGGCCACTACCGGCCTTGGAACCCAGGTCGTCGCCCAGAACCTGCTCTACTCCGACGCT
GGCCTGTTCACCATTCAGATCAGCGGCGGCTCCGCTGCCACCGTCCGGAAAGCCGCCGAAGAGGCCGTCAAGGTCGTCAA
GAGCGTTGCTGACGGCTCTGTCAGCAAGGAGGACCTCACCAAGGCTATCGCCAAGACCAAGTTCGACGTCCTGACCGCGG
GCGAGTCTGGCAGCGCTGCCTTGACTGCTGCTACCGCCGCCCTGTACGGCGCCAAGGCTGCTGACACCAAGGCCTTCGAG
GCTGTCAGCGCTGACAAGCTCAAGACAGTATGTGTCCCCCTCTCGCTCCCCCTCTTCTCACACTTGGTCGCTTGCTAATC
CCCCTCCCAGCTGGCAAAGACCTTCCTGGACGGAAAGGCGTCGTTTGCGGCTGTGGGTGACCTGCACGTCCTGCCGTATG
CTGAGGATGTCGGCCTCAAGGTATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62