GenePrediction:GLEAN_3858 Details

Name: GLEAN_3858
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1327767..1328127 (+ strand)
Length: 361
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1327767..1327798 (+ strand)
Length: 32
Type: CDS
Source: GLEAN
Position: GCSC_113:1327875..1327989 (+ strand)
Length: 115
Type: CDS
Source: GLEAN
Position: GCSC_113:1328059..1328127 (+ strand)
Length: 69
>GLEAN_3858 class=GenePrediction position=GCSC_113:1327767..1328127 (+ strand)
ATGGTGTTCGCGTGGAAAGCCGCAGGCCTGACGTGAGTGGCGCCAATGGGTAGAGGGACACGGAAGCAAGACTACGAGGA
GCCGCCGACCTGACCGTTTCCTTATTAGCTACAACCGCTACCTGGCAGTCGCCAGCCGCGTCGTGCGTCAGAGCCTCAAG
GAGGAGCCGAGACTGGCGGCTGAGCGCCGTGGCCAGGTCGACCTTCGGATCCAGAAGTGGGCGGTAGGTGCACACCCAAC
AATCCGCGAGGAAGAGGCTGTGTCAATTTGCTAACAAGGCTTGGCAATCCAGAACGGCAAGGCCGGCGAGCCGGCAAACC
TGACGAACGACGTTGCCCCCGCTCCCGCCACCTCGGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62