GenePrediction:GLEAN_3859 Details

Name: GLEAN_3859
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1329097..1331871 (+ strand)
Length: 2775
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1329097..1329169 (+ strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_113:1329236..1329364 (+ strand)
Length: 129
Type: CDS
Source: GLEAN
Position: GCSC_113:1329435..1329502 (+ strand)
Length: 68
Type: CDS
Source: GLEAN
Position: GCSC_113:1329583..1329711 (+ strand)
Length: 129
Type: CDS
Source: GLEAN
Position: GCSC_113:1330123..1330539 (+ strand)
Length: 417
Type: CDS
Source: GLEAN
Position: GCSC_113:1330609..1331871 (+ strand)
Length: 1263
>GLEAN_3859 class=GenePrediction position=GCSC_113:1329097..1331871 (+ strand)
ATGGCCAACGATGAGGCTCGGGAGGCCGGAGGGTCTCCCGGTGCAACCCGGGACGAGTCCGCTGTGTCCAGTGGTAAGCC
AGTTATTTTGGACAGTCGATGCCTTTGATGAAGCATCTTGCATTCTCACAATAAGCTAGAACTCCGAGGCCTCTCTCTCA
ATACCGAGCCATCTGTGCCGGCCCTATCGCAGCCACCACCATCCCGGCCCATATCTAGTGGCGTTGTTTCTGTGGACATC
ACAGCTCAGTTCATGGCAGCAGCGGCGAGTAAGAATTCCTTTTTTTTTGCAATGGCCGAATTGTCAGAGCAGAAAGGATT
TACTAACGCTTCATACAGCTCTTGGGCCAGGAGAGCTAATCAAGGACCCCTTCTTCACACTCTTTGAGTCTGTTGGGGCA
CTCGAGGTAAGAGCTGAGCTGAGATTGAATCTTTACCTTACCGTGTTGTGGAATCATGACTGAGTTTGTATGGCTTCATC
AACTAGATCATGGATCCCAAGATGGATAGTGGCTGCCTTCCTGCCGAAGAGCTGGAAGACGACACTTATGATTTTGCACG
TCCTCTGCTTCCCGAGGAGGTTGTCGGAATAATTGACCAGCTTTTATGTCTTGAGGTATGCTACACTTTGCACTTTTTTG
TTGAAATTGCCGGATGGTTCTCTGACCAAATATATAGATGGCCTGGCATCTAGGCTACCCATTGTCTCAGACGATATTCA
CCAGTACCTACATATTCGCAATCCTTTCGCCTATTCCATCGACTATTTCAGAGGTCGACTTCGTCCGTGGCCGCAGCCCA
CAGGAGCTGATTGCGTCTCCTACTCACGCCGTCTTGCGTGCGTATTGCATTAGCCTCATAAAGACGTGCTGGCATGTGAT
AGATAGTGTCAAAGCCCAAACTTATTATGAGGCAAGTGCAAAGCCAGCACAATATCGTCAACAAGGTCTCTCATCACTGA
CTTTTTGATTTGATTGTAGGAAGAGGACTTTGTCACAAACACATATCATCTGTCTCTACTTGATAGCATTACTCGGGAGG
AAGTGCGCCAAGTATTGTTCTCGGCACGGACAGCTGTCCTCGACCCCCGGAAAACAATTGGGCGCAGGATGTTGCTCTGG
CATTAGACGCCCGCCTAGAGTTTCGTGACGCATTTCTTCATGCCATCGAGCTGGCCGAGCTTCGTATTCAACCGGATGCC
CTACAAGTCCCCTGGAAATCAATGTTGGCTGCCATGGAAGGCGTCAAGAAGACACATAAACTGGGCAAGAATTTGCCTGG
AGCTTTTAGTGTCAAGCTGCAGCGTCGACTAGCCAGCACTATGCCACCACGGCCAATCGTACAACCCAGCTTCGATGAAG
CCTGTGAGCGGTGGCTACGCTTCTGCAAGGATGGTGCCAGCGTTATCGACGTCCTCCGCTATGCGGATCCGCAGAGTTTG
CTAGTGAGTGGTAGTGAGAGAAGGTGGTTAGTTGTGTGCTGTTTTGTGTTCAAGGCTAACATCTCCACGTAGAAATTTGT
GCTCACCTTCCAAGCTCAGAAACCACAACCGTTAGTATTCATACGAACACTGATGCAAGATCTGATCTTTGCGGATAATA
TCATGCTTGGCCAGATGAGCATCCGGCAGGTGATGGACGATGACCTGGCGCTGCTGGTGTTACCTGCCAGCATGCTGCTC
GACCCAACAAACGACGAAGTCGAGGCGGTGCAGGATCCACGCTTCGCCGTGGCCCAGCACATGGAAGAGTTCCGACAACG
CGCCTTTCCAGCATACTTTGAAGTATTCCGGACGCTGTGCCAAAACCGCAGCCGAACACGTCGGATGTTATGCCGGGCCA
TCCAGGAGTGGGACAAGCTTCAGATCGACGCAGAGGACATTGACCAACTGGTGGAACATGCTGTGGGTGGTGGCAGGTCG
AGAGGTGGAATGACGTCAGAGGGGCCTACTGCTGCTGATGCCTTGCCTCTATCGTCATGGGCCTTCCTCTATAAACTGCA
GCTGATGGAGTGGGTCACGCAGTTAGGTTTTGAGCTGGAGGTATACCAGGTCGACGAGTTGCCCGGAATGTATTGGTACC
TGAGCTACCTGGCCAAACGGCGGGTGCAGCATGTCGAGCGCATCCGCAGCTTCACTGTGCGGGCTATCCAGGAACACCAG
CAGCCCCGGGCCGGAAGGAAGGCCAGCACGCTGTCAACAGCCGAGCACACGGCCTACGTGCGGTCGCTGGCGTTTCTGCG
CGCAACCCTGATTGACGCATCGGCGAGCTGGGAGCTGGCCGAGGCGCTGTCTTGCTTCTATTCGGTCCTGCAGCGGACGG
GAGAGATGCCTATTCCAGACCGACCCTTTGGCAGCGAGGAGCTGCGCTACGAGTTGCGCATGCGGCCGTTTGCTGCTGGT
GGCCCATCGGAGCTGCCGCCCTTTGATATATTTGCCGCGGAGGTGAAGCAGGCCGACAGAAGCGTGGCCGAGATGCTGAC
GTATGCTGAGAAGGCTGTCGGGGCGGCCAAGAAGGGGTTTGAGGCTCTGACCAAGCTCGACGAGCGCGAAGAGTCCTTCT
CGGCCTTCTGCCATGACAGATGGGTGGCGCGGACAAAGGGTATGCAGAAGTCAGCCATATTTGCCGGCATCGCAGTGGCG
ACGGCACAGAAGGCAGCATTGGACGAAGGCACACAAAATCGGTCCAGACTGACGATCGAGGTGCCCACGCCGGACAAGTG
CTATCACGAGTGGTGGGTCGTTCCAAAGATCACCATTAAGCCGGCTGCAACATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62