GenePrediction:GLEAN_3861 Details

Name: GLEAN_3861
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1341923..1344758 (+ strand)
Length: 2836
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1341923..1342361 (+ strand)
Length: 439
Type: CDS
Source: GLEAN
Position: GCSC_113:1342442..1344475 (+ strand)
Length: 2034
Type: CDS
Source: GLEAN
Position: GCSC_113:1344619..1344758 (+ strand)
Length: 140
>GLEAN_3861 class=GenePrediction position=GCSC_113:1341923..1344758 (+ strand)
ATGTCGACCCAAGTCCGCACCTTTACGGCTCCCAAACCGCTGGGCGAGTCACTCTCTAGTGCTGCGTCCATCGCCACAAA
CCTGCAGTCACCCTATATTCCCAGATCTGTCCCTACATACCCGGACATCCCTCGCTACAACGCAGGTGGCTCCCGGGCTC
AGATCAAGCCAAGCTCCATGTCTGCCTATGTCAACGACCAGGCCGGCGGGAACGGTGGTATCACGTTTGCCCACCAGGAC
AGCCTGCCGAAGCTGCCCATCCCAGAGCTGGAGAGCACCCTGCAAAAGTATCTGACCGTCCTACGACCACTGCAGACGAC
GCGCGAACATGCGGAGACCAGAATCGCAGTGGAGGAGTTTCTCAGGCAGGATGGGCCTGAGCTGCAGGAAAAGCTGAAGA
AATACGCCGAAGGCCGCACGAGTTACATTGAGCAGTTCTGTATGTTTCCCCCCTTATCCTTTCCCTTTTCCCTTTTCTCA
AGTCTCGTTTTCCTCTTTCGTGTTGGCTGACCATCCAAGGGTACGATTCATACCTGAACTATGACAACCCGGTTGTGCTT
AACCTCAACCCGTTCTTCCTGTTGGAAGACGACCCGACACCGGCGCGCAATAACCAGGTGAACAGAGCGGCGTCGCTGAT
CGTGTCGTCGCTCATGTTTGTCCGAGCCGTACGAAAAGAAGAGCTGCCACCGGACACAATCCGCGGGACTCCGCTGGACA
TGTACCAGTACTCGCGGCTGTTTGGCACGGCCCGCGTGCCTACCGACAACGGGTGCCAGATCGAGCAGGACCCCGAGTCC
AAGCACATCGTGGTGATGTGTCACGGCCAGTTCTACTGGTTTGACGTTCTCGACGATAACTCGGACCTGATCATGACGGA
GCGGGACGTTGCGCTGAACCTGCAGACAATCATCGGCGACGCGACACAGACGCCGATCCAGGAGGCTGCCAAGGGGGCAC
TGGGGGTGCTCAGCACGGAGAACCGCAAGGTGTGGTCGGGGCTGCGCGACGTGCTGACACGAGAGGAGGGGTCGAACAAC
GCGGACTGCCTCAGCATCGTGGACTCGGCGCTGTTTGTGGTGTGTCTGGACTACACCGAGCCAGCGTCGGCGGCGGCGGT
GTGCCAGAACATGCTGTGCGGCACGAGCGACATCGAGAAGGGGGTGCAGATCGGAACGTGCACGAACCGGTGGTACGACA
AGCTGCAGATCATCGTGTGCAAGAACGGCAGCGCAGGCATCAATTTCGAGCACACGGGGGTGGACGGGCACACGGTGCTG
CGGTTCGCTAGCGATGTGTACACGGACACGATCCTGCGGTTTGCGCGGTCAATCAATGGCCAGGCGCCGTCGATGTGGAA
GTCGACAAGTCCCGACCCGGCAAGGCGCGATCCGGAGAGCTTTGGTGACGTGACGGCGACGCCGCACAAGCTGGAGTGGG
ACATGGTACCGGAGCTTACGATTGCGGTGCGGTTTGCGGAGTCGCGGCTGGCCGACCTGATCGAGCAGAACGAGTTCCAG
TGCCTGGACTTTGGGGCCTACGGCAAGAATTTTATCACCAGCATGGGCTTCTCGCCAGATGCATTTGTGCAGATGGCTTT
CCAGGCGGCATACTACGGGTTGTACGGGCGGGTGGAGTGCACGTACGAGCCGGCGATGACCAAGGTGTACCTGCACGGAC
GGACGGAGGCGATCCGCAGCGTGACGGAGGAGTCGGTGCACTTTGTACAGACCTTTTGGGCGGACAACCAGGCGGAGCTC
AAGGTGGAAGCACTGCGACGGGCGTGCCAGCGTCACGTGACATCGACACGGGAGTGTTCCAAGGCACAGGGCTGCGACCG
GCACCTGTACGCGCTGTTCTGTCTGTGGCAGCGGCTGGCGGACGACGAGCTCTTCAGCAACACGGGGACGGGGACGAGCA
GCGCGGACTATGGCAGCTCGTTCGGGTCAGAGCGCGGCTTCAGCCCGGTGCCAGAGGAGAACGGCAGCGTAAATAGTCAC
GGGAATGGTCACGTGAACGGCAACGGTAGCAGCAGCAACGAGACGCCGGCGCGGGCGCGAGGCGACAGCACGGGGTCGCG
GCAGAGCGGGCAGCACATGCCGGCGATTTTTCTGGACAGCGGGTGGGACAAGCTGAACACGACGATCCTATCGACGTCCA
ACTGCGGCAACCCGTCACTGCGGCAGTTTGGGTTTGGACCCGTGTCTGGCGACGGGTTCGGGATTGGCTACATCATCAAG
GATGACGGGATCAGCATCTGCGTGTCGAGCAAGCACCGGCAGACGAAGCGGTTCGTCGACACGCTCGAGAGCTATCTGCT
GGAGATGCGACGAGTGCTGCGAATTACGAGCCGGCGGTTGGGGTCGATATCGTCGAAGCAGATGTCACGGGCGCGTGAGA
TTGACAATATGCGGCCGCGGCCGCCAACGCGAGTCAAGTCACGCGGTCGTCTGATCACCGGCGGCGACGTGATCAAGAGC
ATGTCGCGTTTGGGGACGGAGTCGCCGACGACTGACAGCATGGCGATGAGCGAAGACGACGAGTTGGGCGGATGTGAGTT
TTTTTCTCTTCTCTTCTTTTCTTTTCTTTTTCTTTTCTTTTTCTTTTTCTTTTCTTTTCTTTTCTTTTCTTTTCTTTTCT
TTTCTTTTCTTTTCTTTTCTTCTTTTTTCTTCCTTTCTGTCTGCTAACACCAATAGACGGCTTCTTTGATGCAGGAATGC
TGCTGCAGGCACTCAAGGCTCGCAACGAGGGTTATGACCTCGGCGAGCCAAAGCCGTCGGAGAGGGCGTCTCGACGTCGG
GACATTGGCAAGAAGCTGCGGCTGATCGACTACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62