GenePrediction:GLEAN_3863 Details

Name: GLEAN_3863
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1351155..1352363 (+ strand)
Length: 1209
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1351155..1351888 (+ strand)
Length: 734
Type: CDS
Source: GLEAN
Position: GCSC_113:1351961..1352363 (+ strand)
Length: 403
>GLEAN_3863 class=GenePrediction position=GCSC_113:1351155..1352363 (+ strand)
ATGGCGGTTGGCTCCCTCCCCAGCTTCTCACAGGCGGACATTCAGTCGCACAAATCGAAGAGCTCATGCTTCGTTACCCT
TGGCAACAAGGTTTACGATGTCGCTGATTTCATCGAATCGCATCCCGGTGGGCCTGAGCTGATTATCGACTATGCGGGCC
AAGATGTCACCAAAATCCTCAAGGATGAGGCGTCGCACACCCACAGTGACTCTGCCTACGAAATGCTCGACGAGTATCAT
GTAGGCTTCCTGCAGAAGTCGGGCAAGACGGCAGAGGCCAATGGCGTATCCTCGGGCGTCGAGACGAGCAGCGACGAGGA
GACCACATTCGTCCACCCACGTACGGGCATGGCATGTGAAGAGGACCTGAGCAAGGACACTGATATCGTATCCGACTACA
AGAAGAACAAGTTCCTCGACCTGAACCGTCCGCTTCTGATGCAGGTCTGGTTCGGCGGCTTCTCCAAGGAGTTCTATCTG
GACCAGATCCACCGGCCCCGTCATTATAAGGGCGGCAAGTCAGCGCCGTTGTTCGGCAACTTCCTCGAGCCTGTCTCATT
GACGCCGTGGTTCGTCGTCCCAATTGTGTGGCTGCCATGTGTTAGCTACGGCTTGTACCTCTCCAGCTTCGGCTTTGCCA
ACGTGGGCTACCAGGCGCCCTTTTTCGGCTTTGGACTCGTAATCTGGACGCTAATCGAATACGTCCTGCACCGCTTCCTC
TTCCACTTGGACTAGTATGTTTACCCTGATGGCATGTCGGGTCCCGTTTCTTCAAAGCTACATGCATACTGACCGCCGCT
TCACAGCTATCTCCCTGACAATCGCGTCGGGCTCACCCTCCACTTTCTGTTGCATGGCGTCCACCACTATCTTCCTATGG
ATAAGTACCGGTTGGTGATGCCGCCGACGCTCTTTGTTGTCTTGGCCACGCCATTTTGGAAACTGGCCCATTTCATCTTC
GCCTATGACTGGAACGTTGCCACTACGGTCTTCTGTGGAGGCATCTTTGGCTACGTCTGCTACGATCTTACCCACTACTT
CCTCCACCACCGGGACCTGCCTTTGTGGTACAAGGGCCTGAAGAGGTACCATCTTGCCCATCACTTCCTTGACTATGAGC
TCGGCTTCGGCGTTACGAGCCGTTTCTGGGACCAGGTCTTTGGCACTGAGCTCAAGATGAACACGCCTCCTATTGTCAAG
GCCCAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62