GenePrediction:GLEAN_3864 Details

Name: GLEAN_3864
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1352941..1354899 (+ strand)
Length: 1959
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1352941..1353692 (+ strand)
Length: 752
Type: CDS
Source: GLEAN
Position: GCSC_113:1353760..1354074 (+ strand)
Length: 315
Type: CDS
Source: GLEAN
Position: GCSC_113:1354134..1354899 (+ strand)
Length: 766
>GLEAN_3864 class=GenePrediction position=GCSC_113:1352941..1354899 (+ strand)
ATGGCTCACCTCGATGTAGAGGCTCTTTTGGATGCGGCCGCGAACGGCGACAGCGGCCCGAAAGGACAGAATGGGAAATC
CGAGACGCTGCTGAACGGCCACGGATCAACGAATGCTGATGACGCCGACAAGTATGCCAACGGAAAGAGCCACAGCAATG
GCGGCCGCAGTCCCGACGAAAACGGCCGCAGCCGGCATCGCACGCGAAGCCGCAGTCCCGAGCGCGAAGAAGACCGAGAG
CGCGATCGTAGACGGCGGGATCACCGCAGTCACAGTCCGCGCAGCGAAGCCGGCAGCCACAAGAGCAGCAGGCGTAGAAG
CCGGAGCAGAGACCGGGAGCCGCGCGCGGGTCGAAACTCACGGCGCCGGAATCGAGGGCGCGGTGGTGGCGGTCGTGGTG
GCGACGATGTGATGGACGGCGATCATTACTCCTCCCGGAACGGACGCTCGCGATCACGGTCTCCGAACCGATACTACCGC
CCGCGCGACTCGCGACGCGACCGTGATGATGACCGCGGTGGCCGGCGACGCGACGACCGGGATTCTGACCGCAGACGGCG
CGACCGTTCGCCCCATTCCCGCGACACCTCGATGCCGCCGCTGACTGAGGACGAACGCGACCGGCGGACCGTCTTCGTGC
AGCAGCTGGCCGCAAGACTGCGCACGCGCGAGCTGAAGGACTTTTTCGAGAAGGCTGGGCCCGTGGCCGAAGCCCAAATC
GTCAAAGACCGTGTTAGCAACCGATCCAAGGGGTTAGTTTACCCTCTCTTTTCTTTCCTAGTCCATTTTCATGGCCTTGC
CTTTGCTAACGACGACTAGAGTTGGCTACGTTGAATTCAGAAGTGAAGAGTCCGTCACGGCTGCTCTTCAGCTCACAGGT
CAGAAACTGCTAGGTATCCCTGTCATTGTGCAGATGACGGAAGCCGAGAAAAACCGACAAGTACGTAGCACAGCAGAAGC
GACGAGCAACGGTAACTCTACCGGAGTGCCCTTCCACCGTCTGTACGTGGGCAACATCCACTTCAGCATTACCGAGTCCG
ACCTACGCAACGTATTTGAACCGTTTGGCGAGCTCGAATTTGTCCAGCTGCAAAAAGACGACACTGGCCGCAGCCGTGGC
TATGGTTTTGTGCAGTGGGTTTTGCCTTTTCCGATGCATTTTGGTTTCTTTCGTTCGAAGACTGACACTACAGATTTCGT
GACTCTGACCAGGCTCGTGAGGCACTGGAGAAGATGAACGGCTTTGATTTGGCAGGGCGCCCCATCCGAGTTGGTCTCGG
AAACGATAAGTTTACCCCAGAGTCAACTGCGAATCTGATGAAGGGGTTCCAAGGTCGCGACCAGCAGCAGCAGCATCAAG
GCTCTGCCTTCTCCGGCTCTGGCGGCCGGGGCCAAAATGCGAGCAACTTTGACCGTGCCGGTGGCCGGGACAACGACAAA
GGTAGTGGCGCGGGTGCTCTAGATGACACTGACGTTGCTGGCGTCAATTTCAATAACTACAGTCGAGACGCCCTCATGAG
GAAGCTCGCTAGGGCCGACGATTCTTCTGCCAACGGTACAGGTGGTGGCAGCACCTCGGCTGCGGCTGATGAGCAGCAGC
GACCGATTCTGAAACCCCGGACAGAAGCAAAACCGCTCCCGGTTAACGTGAATATGGCAAGCCGATGTGTGGTCCTGCAC
AACATGTTTGACACATCCGAAGAAGAGGGCGAAGAATGGATCAAGGAGCTGGAAGACGACGTCCGCCAGGAAGCCGAAGA
AAAATACGGTCATGTGGTTCACGTTGCTTTAGATCCGAACTCGATCGGCGATATCTACCTGAAGTTCGACAAGGTCCAGG
GCGGCGAGAATGCCATCAAGGGCCTGAACGGCCGCTATTTCGGTGGTCGCATGATCACGGCTGCACCGGTTGTGGATGCC
GTCTACAGTAGTTTGTTCTCTCGCACAAAGGCGATCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62