GenePrediction:GLEAN_3865 Details

Name: GLEAN_3865
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1357857..1359928 (+ strand)
Length: 2072
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1357857..1358180 (+ strand)
Length: 324
Type: CDS
Source: GLEAN
Position: GCSC_113:1358251..1359382 (+ strand)
Length: 1132
Type: CDS
Source: GLEAN
Position: GCSC_113:1359465..1359928 (+ strand)
Length: 464
>GLEAN_3865 class=GenePrediction position=GCSC_113:1357857..1359928 (+ strand)
ATGAGGTTGCAACAGGCCACCAACACGCAAGTCGGCCTTACTTCTACAATCCGCGAAGGCTGGTTTGACGAGCTTCGTCA
CGTTGCTCAATGTTTCATCACAGCACAGCAGGCCAGCGCCAAAATCGAGCAGGCCATCAATACAGAGCGTGCACAGCTTC
AGGGGGCCCTTTCAGCTGCTCTGAATGAGCGTGATGTGACGAAATCAGAGCTGGATTCCGCTCGACAAGAAATTCGATTT
TTGCGCAATCGAGTAGACGAGCTGATGAGCAAAGCGTCAACACAGCATCACGTCGATAGTTCATGGACAAACTCTACTTA
CGACGTAAGTATACCCATGTCCAGAGCCTCTACAGATATCCTGGTGTCCATAACTAATTTCTGGGGTTTTCTAGAAATCA
ATCGCTCGGTCGGTCCCTGAGTCTCAAGTCGAAACCTCAAGTTGGCTCTCGAGAAGCTCTAGCCAAGACAGTCCTAGTGA
TGTCTCGCTCAACGACAGTTGCGTCGATCTGCTTCAGCAACTTCCCACAAAAGTGGAGGACATGCCATTCACACCAGAGC
GAAAGCCGACATCCTTGCCCTATAAACATGATGGCAACGCTTACAGATCGGACACGCCTGGTGACTGTCAACCTTTCAGG
TCCTCGGCGGACCAGATATATAGTCAGAGTGACCAGTTGAAACCCTTTGTCAGAGAGTATGGGCCTCTGGTGCAGCGGAC
CAAGTACAACGGAATAATTGCCAAGACTCCCGATTTCAGTGGTAGCCTTGCAGAACGTCACAGAAATAACAGCAGCACCA
ATGGCCACAAAGCAGCTGGCCGCTTTAACCGAACACCGTTTTCCTCACAGGGACCCTTTGCTCCTCCTCCCTCGCAGCAC
CAACCTGGTAATGCCTTCCGTAGCCAGCATGATACGAGAGTTCGTGCATCTACGCCGACGCAGGGATCGAATATGGGGAT
GCAGTCGGCAATTCCGCCTCGCCAAAATCAAAGAGAGCTGCACCAGAAGCCCTACCCACAGCTGCAGCAACGACAGACCT
ACCCTGGCCCCGATACTCCAGGTCTGCTGGAACAGGGCTTGGTGCCTGCGCCCTCTATGGAGCTGGCTTTGGTCCAGAGC
CGGTACGAGCCTTTCAATGAGTATGCTCCAGGGGTTGCACCTCTGAACACATCCGACGAGGAGCGTATTCGAGATATCTT
CCATTTCTTCAACAAGATGACAGACTGGGTCACTAGATACTGCAGCGTGCCAAACAAGAAGCTTATCAACGACATGGAGC
GGCTGTTTCCTCGGCTCTGGGACTATGCCTGCTCGGCGACATATCCGAACAAGGCGTCGAATGCCGCCAGCCACTCCATG
TTCATGCTGTCGAGCGATGAGTTCCGAAAGTACTTTTTGACCCGGCTCCTTATTCAATATGTGGTCCAGCAGATGTGGAA
CGCTCAGGCGTGGGAGGGTCTCGACGACGAGTTAACAGAGGTCCTGATGAGCGTCAAGCACCGCCTGGACCCCAAATACG
GTTATGGTGAGTGTGATGCAGCACCCCAAATATGCAGCAAATGAAAAACAAAGAGATCGAAGTAAGGAAAGCTGACGAGG
CTGTACAGATGCCATCCTGCAACCACACGAGCGTCATGCACTTGTGGAGAAGCGCTCGCGCGCGATCTACGACTTCATGC
GACAGCCATCCTGGAGCAAGATTAAATCACAGAAGATGAACGTGGCGCTGACACGGTTCAAGGACATTGTCGGACCTATG
ATGAACCGGGAGGACATTGATCGACAGGCGGCTCTGCACGAGCTCTCGGGCATCAGCGAGGGTGCGCTGCGGCTTTCGGC
CATCCTCAACACATCGCGGCTCTCCTTCCAGTTCATCTTCAACGAATGCGGCATCAAGTTCAGCGATCAGTCGCACCGGC
CGCTCAACGCAAGCCTGCCAACGCGGGAGCTGCAGGCACACCACTGGCGGCTGATGTGTGTGGTGACGCCTGGCATCACG
TATCGCAACGATGCCGGCGTCAGCGTGGACCCGCGCTTCCTGGCCAAAGCCAACGTTCTGCTGATGCAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62