GenePrediction:GLEAN_3866 Details

Name: GLEAN_3866
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1363676..1365346 (+ strand)
Length: 1671
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1363676..1363766 (+ strand)
Length: 91
Type: CDS
Source: GLEAN
Position: GCSC_113:1363859..1364334 (+ strand)
Length: 476
Type: CDS
Source: GLEAN
Position: GCSC_113:1364419..1364676 (+ strand)
Length: 258
Type: CDS
Source: GLEAN
Position: GCSC_113:1364738..1365346 (+ strand)
Length: 609
>GLEAN_3866 class=GenePrediction position=GCSC_113:1363676..1365346 (+ strand)
ATGAGCAGCAGCCGCAGAATCAGCATCAACCGGAACACGGGTGTCCCCAAGCCCTCCCGCCGCTTCTCCTTTGCCGAGCC
TGGTGTCAACGGTATTTCCTGTCTCTCCGGCCTGCTTGCCGCCGCATCCGCACAGCTAAACTACTGGCCTTGGCTGACCT
TCGCTGACTTTCTTCCCCTCCAGAGGCTAGCAGCAAGGTCCACCGTCAGTTTCGCGCTGCCCACGAGGGCCATCTGCCTC
ATGCCGGCCTAGACGCCACGCGTGCCTCGACCGGCGTCGTCTGGTGCACGGAGCGTGCTGCCGAGTTTGGCTTCCTCGAA
GAGCCCGAGCTCTGGGCCAACCTGGGCCAGGGCGCCCCCGAGGTCGACGACGACATCGAGGGCTGCTTCCCGCGGCCCCA
GACGCTTGACATTGGCGTGGCCAGTCGCGAGTATGGCCCAACCGCCGGTATCAAGCCTCTGCGCGAGGCCGTCGCCCACC
TGTACAACGAGCACCATCGCCAGGGCAAGGAGAGCAAGTACACCTGGGAAAATGTTGCCATTGTGCCCGGTGGCCGTGCC
GGTTTGATCCGCATTGCTGCCGTGCTGAACAATGCCTACGTCGGCTTCTTCATCCCGGACTACACTGCCTACAACGAGAT
GCTGTCGCTGTTCAAGAATGTGAGCGGCCCTCTGTCCTCTGTTTTTTGATTTTCCACTTCCCCATTTCTTGTTTTTTGTT
CCCGACTCACCGCCTTTCCACAGTTTGCCGCCATCCCTGTCCCTCTTAGCGAGGAGGATGGCTACCATATCAACCCGGAA
AAGATCTCGGAGGAAATTGCCCGTGGCACTGGCGTCATCCTGACTTCCAACCCGCGCAACCCCACCGGCCGCGTCGTGGC
CAATCCGGAGCTGGCTGAGATCCAAGACCTGTGCCGTGATCGTGCCACCCTGATCAGCGATGAGTTCTACTCGGGCTACA
ACTACACGAGCGACTGCGACGGCACCACCATCAGCACTGCTGTAGGTTTCCCCGTTGCCTGTCCATTCCGCTGTCACACG
TGCTGACCCTGTTCTTCGCCAGGAAAACATCATCGATGTCGATGAGGACGATGTGCTCATCATTGATGGCCTCACCAAGC
GCTTCCGTCTGCCTGGCTGGCGTGTGGCCTGGATCCTCGGCCCCAAGGAGTTCATCAAGGCCATCGGCTCCTGTGGCTCC
TACCTGGACGGCGGTGCTAACGTGCCCTTCCAGGAGGCTGCCATCCCCATGCTTGAGCCTGGCCTGGTGCGCCAGGAGAT
GATTGCTCTGCAGCACCACTTCCGCGAGAAGCGCGACTATGTTCTTCGCCGTCTGCGCAGCATCGGCTTCGTCATCAAGT
ACGTGCCCGATTCGACCTTTTACCTCTGGCTCAACCTCGAGGGCCTCCCCGGTCCCATCAGCGACGGCCTCAACTTCTTT
CAGGCCTGTCTGGCCGAGAAGGTCATCGTCGTGCCGGGTATCTTCTTCGATCTGAACCCGGCCCGCCGTCGGGACCTGTT
CGACTCCCCGTGCCATCACTTTGTCCGCTTCTCGTATGGTCCGCGTATGGAGACGCTCAAGCTGGGATGTGACGGCATCG
AGCGTGTCGTGAACAAGTATGTATCGTGGACGTCCAGAGTTGCATATTTTCCCTTGGCTAACCCCGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62