GenePrediction:GLEAN_3867 Details

Name: GLEAN_3867
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1375307..1376215 (+ strand)
Length: 909
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1375307..1375376 (+ strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_113:1375450..1375512 (+ strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_113:1375583..1375642 (+ strand)
Length: 60
Type: CDS
Source: GLEAN
Position: GCSC_113:1375719..1376215 (+ strand)
Length: 497
>GLEAN_3867 class=GenePrediction position=GCSC_113:1375307..1376215 (+ strand)
ATGCCTGACTGCCAGAGCCCCAAGACCTGGAAAGAGGACCTGCGTCTCCGTGAGGAGTTCTGCTTGGCCCGTAAGTCTTT
CTCTACCTTTTCCGGCAGCCTACTGCTTCATTTTGCCCAAAGTTCTGAGACTGACATGTCTAGACCTGTGCCGCAATGGC
GACTGCGCTTCTAATGTAGAGGACATGCATTTGTACTGCGATGAACGTACGTTACTTCTCATCACCTATTACACCCCCGT
TGGATGTGCCTGGTTATATGCTGACTTCCTATTTAGACGAGTGCTCCAAGCCCGGCTGCGTTGCCCGGATTTCTGGAAAC
AGTCTCTGTCATGAACGTAAGCGCTCTCTTCCCTCTCAATTATGACATACCCATCTGCGTAAGAACTAACCAGGCTTCGC
TCCCCTTATCAGATGCCATTCTGCAAAACACACAGACCATTAGAGAAGCTACCAAGTCCGAGTCACAGGGCTGGATCAGA
ACACTGCAGCCTCGTGACTACAGCCCAGCAGCTGGCCAACAATATACGTTGCATATGCGTGATGGAGGTCGCCGCTATGA
GATGTTACCACCATCTCCGCCGGCTCGAGCCTTTCCGTCCCATCACCAGCGGTACGAAAGTCGCCCGTACGGCCATCCGC
CGTCTCCGGAAACACCCTTCGATTCGCCGGCGTCAGATATTGATGAAGACGAAGTGCTACCAGGCCACAACAATGGTCCA
TCTGATCCGGTACGTGGCAACATCGGAGTCGGAGCGAGAGCCAACAGCGGCAATGGTAGTGGGGTTTTGCCTGCCGGAGT
CATCCTTCAGAAGAGGGATGCACCAGTCGACAAGCCGTCATCACTGAACGTTCAGAACATGCAAGGAGGGCCTGGTCGCG
TCGGAGGTGGCACAATCCAGCGGCCTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62