GenePrediction:GLEAN_3868 Details

Name: GLEAN_3868
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1380282..1381522 (+ strand)
Length: 1241
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1380282..1380313 (+ strand)
Length: 32
Type: CDS
Source: GLEAN
Position: GCSC_113:1380382..1380470 (+ strand)
Length: 89
Type: CDS
Source: GLEAN
Position: GCSC_113:1380546..1381522 (+ strand)
Length: 977
>GLEAN_3868 class=GenePrediction position=GCSC_113:1380282..1381522 (+ strand)
ATGGAAGGCCTTTTCTTCAACGCCAACAATGGGTGAGATTAGCGGAAAGATGCTTCTTATGTATTAAGGTCTAGTGCGAT
GGCTAATCTTCATCCCTCAGGTACATCGAGGGTATCGTCCGAGGTTATCGGAACGGGCTTCTCACCAATGCCAACTACAC
CAACATGACGCAATGCGAGAACATTGATGGTGTGTTTTCAACTTCCATCTGCCATCTGAACCCCCCCGCGTGCCTTGTCT
TAGCTGACCAACGTAACCTGATAGATCTCAAACTTCAGCTTGGTCCTGCTTATGGCGACTTCCTCGCCTCCCTACCTCCA
AACCCGTCGACGTCTAGTTTGGCGGCAAAGACGACCGACAAGCTCGTTTCCGAATTCCGTTACGTTCGTGCGAACGCGTC
CGGGTCTTTGGCACAGTTCATGGACTATCTTACCTACGGCTACATGATTGACAATGTCGCTCTGCTTATCACCGGCACTC
TTCACGAGAGGGATACGCGCGAACTCCTTGACCGGTGCCACCCACTCGGCTGGTTTGAGACGATGCCTGTCCTCTGCGTT
GCGACGAACATCGAGGAGCTATACAACAGCGTTCTCATCGAAACGCCTCTTGCGCCCTACTTCAAGGGTAGCTTGAGCCA
CACGGATCTCGACGAGCTGAACATTGAAATTGTCCGAAACACGCTGTACAAGAACTATCTCGAGGACTTCTACAACTTTG
TCAACACGCATCCAGAAATGGCCGGCACACCAACATCCGAAGTCATGTCAGAGATCCTCGAGTTTGAGGCAGACCGCCGC
GCCATCAACATTACCATCAACTCGTTTGGCACGGACCTGTCCAAGGCCGACCGCCACAAGCTTTACCCAACATTCGGCCT
CCTGTACCCCGAGGGCACCTTGATGCTCTCCCGCGCCGACGACGTGGAAGGCGTCCGGCTGGCCGTTGATGGTGTCTCCG
ACTACAAGGGCTTCTTCGAGGCTGTCAACCTTGGTGGTGGGTCCGCTGGCCCCGGCAACATGGGCGGTGGCGCAGCTGCG
GATGGACGGAGCTTAGAAGACATGTTCTACCAGAAGGAGATGGAGATTTCCAAGAATGCTTTCACACGGCAGTTCACGTT
TGCCATCGTCTACGCATGGGTTAAGCTGCGCGAGCAAGAGACCCGCAACATCACGTGGATTGCTGAGTGCATCGCCCAAA
ACCAAAAGGAACGTATCGGCAACTACATCAGCGTCTTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62