GenePrediction:GLEAN_3869 Details

Name: GLEAN_3869
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1383266..1384316 (+ strand)
Length: 1051
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1383266..1383435 (+ strand)
Length: 170
Type: CDS
Source: GLEAN
Position: GCSC_113:1383543..1383991 (+ strand)
Length: 449
Type: CDS
Source: GLEAN
Position: GCSC_113:1384045..1384316 (+ strand)
Length: 272
>GLEAN_3869 class=GenePrediction position=GCSC_113:1383266..1384316 (+ strand)
ATGGCGTCCGCCAACCTTCCCGCTATCTTCAATGCCACGAGCCAGGACATCGAGGTCCTCCTGGCAGCTCAGTGCCACAT
CGGCTCCAAGAACTTGCAGGTTCACATGAACCCATATCTGTGGAAGACTCGCGCCGACGGTGTCAACGTCATCAACATCG
GCAAGACCTGGTACGTTTGCTATTTCCGAGTACAGCGTTCCACGAGACGTGCAGCTCGAAGAAGTTGTAGACTTCGAGAT
GTGAGAGTTGGAGAATCGTGCTGACAGCTGTGTTCAGGGAGAAGATCGTCCTCGCTGCACGCATCATCGCCGCTGTTGAC
AACCCATCGGATGTCTGCGTTATCTCCGCTCGTCCGTACGGTCAGCGCGCCGTCTTGAAGTTCGCCGCCCACACCGGTGC
TCAGGCCATTGCCGGTCGCTTCACTCCCGGTTCGTTCACGAACTACATCACCCGCTCGTTCAAGGAGCCGCGCCTCATTG
TGGTGACGGACCCGCGCACCGACGCCCAGGCCATCAAGGAGGCCAGCTACGTCAACATCCCCGTCATCGCCCTGTGCGAT
ACCGACTCGCCGACCGACTTCGTCGACGTTGCCATCCCCACCAACAACAAGGGTCGCCACGCCATTGGTGCCGTTTGGTG
GCTGCTGGCCCGTGAGGTCCTCCGTCTGCGCGGTACCATCTTCAACCGCGAGACCCCCTGGGACGTCATGGTGGATCTGT
ACTTCTGTATGTTTTCTGTCGCCCTCTCGCTCCTGTGACCACTTGACTAACATGCACAGACCGCGACCCTGAGGCTGAGG
CCGAGGAGAAGGCCGAGGAGGAGAAGCTCGCAGCCGTCGAGGAGGAGCCCGTTGTTGCCGAGGCCCCTGCCTTCGGTGGT
GGCGACTGGGAAGCTGCTCCGGCTGGCTTTGCCGGTGCTACTGGCGCAGCTACGGCCACTGCTACTGCCGGCTGGGACGA
TGCTGCTCCCAACCAGCAGTGGAGCGCTGAGACCGGTGGTGCCCAGTGGGGTGACGACGCTGCTCCTCCCAAGGAGGGCA
CTCAGTGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62