GenePrediction:GLEAN_386 Details

Name: GLEAN_386
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1467847..1469381 (+ strand)
Length: 1535
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1467847..1467865 (+ strand)
Length: 19
Type: CDS
Source: GLEAN
Position: GCSC_167:1467931..1468105 (+ strand)
Length: 175
Type: CDS
Source: GLEAN
Position: GCSC_167:1468194..1468243 (+ strand)
Length: 50
Type: CDS
Source: GLEAN
Position: GCSC_167:1468312..1469096 (+ strand)
Length: 785
Type: CDS
Source: GLEAN
Position: GCSC_167:1469313..1469381 (+ strand)
Length: 69
>GLEAN_386 class=GenePrediction position=GCSC_167:1467847..1469381 (+ strand)
ATGCCCGAGATTGCCGAAGGTCGCCCAGCCAATCCTGTGTAAACACAAGCTTCCGAACAGCTGCTGACATACCTCTGTAA
CCAGCTGCCCGGATCGTGCATTTTCTCCGCAAACACCTTGTCGGCAAACAGATCAAGAAGGCTGCAGCTATTGATGATAG
CAATGTATTTGGAAAGGCTGGCACAACCGGTGCCACCTTTGCAGCCAGTGTGCTGGGAAAGAAAGTCCTGTCTGCCGGTA
GCCAAGGCAAATACTTCTGGTGCGTGGTTGAATAAGATTCCATCACATCCATTCATTCGCGCGCGTACATGGCCCTCTTT
GGTTCAAATTCTGACAGCTCCCTGCAGGATCGTGCTTGACAGCCAGCCGCATCCGGTTATGCACTTTGGCATGACAGGTA
GGACACCGCTGAAAAAGCCGAATCATTCATCTTTGTAGCCTGTCTTGTCTGACATAATCTACCAGGATGGATTCACATCA
AGGGAATGCGTACAGCGTACACTAATTACTACAACAAAATGAAGCCCGGCGATGCCGATCTTTGGCCGCCCAGATTCTGG
AAATTCCATCTCCAGGCAGAAGCTGATGGCGCTGCTGACAAGGTTGAGCTCGCCTTCACGGACCCCCGGCGCTTTGGTCG
CGTCCGCCTCATCGACTGCCCTGGCGACCGCATCCGCCAATTCTCCCCGCTGGTCGAGAACGGTCCAGACCCGGTCGTGG
ATGCCGACATCTTCACTGAGTCCTTTGTCCGCGACACCATGCAGCGCCGTCACGTGCCCATCAAGGCCCTGCTGCTCGAC
CAGGCCTTTATCAGCGGCATCGGCAACTGGGTCGGCGATGAGGTCCTTTTCCAGGCGCGCCTGCACCCAGAGCAGTATTG
TGACGAATTTGATGGCGCTCAAGTCAAACAGCTGTATACATCCATCTGCCACGTGTGCCGCACCGCCGTCGATCTGCTCG
GCGACTCGGACCGCTTCCCAGACGACTGGCTCTTCCACTATCGCTGGGGTAAGGGCAGCAAGGGCGCCGTCCCGCAGCTT
CCGGGTGGCGAAAAGCTGTCCTTCCTCACTGTCGGCGGCCGGACGAGCTGCTTCGCGCCAAGCCTGCAAAAGAAGAGCGG
CGGCGTGGCGCCAGGAATCAAGGAGGAACCAGTCGTCATCAAGGGAGATGGAGTAGAAAGAACTAAAACGAAGCAGGCGA
AAGAGACCAAACAAGCGAAACAGGCCAAACAAGAGATCGAAATGCAGTCGGTAAAGCGGACAAGAATAAAGAAAGAAATT
TCCTGGGCCAAAATAGAAAGTACAGCTGTCGCTGTTACGGTGGAAACTCGAAAACGAAAGCGCACTATGCTGAAAACCGA
GCCAGAAGAATCAGAGGAGCCAGTCGTGGAGAAAAAGCTGCCAGCAGAGAAAAAAAGGAGGGCACAAGCAGCTGACTCTC
GGCAGACACGAGCTAAAACCACGCAGGCGTTGCCAAACGCGAAACTCCCTTTGAATCCAGGCCGAAGACGTTCCGCCAGG
CTCACTGGAAATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62