GenePrediction:GLEAN_3872 Details

Name: GLEAN_3872
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1407941..1410904 (+ strand)
Length: 2964
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1407941..1407959 (+ strand)
Length: 19
Type: CDS
Source: GLEAN
Position: GCSC_113:1408058..1408215 (+ strand)
Length: 158
Type: CDS
Source: GLEAN
Position: GCSC_113:1408281..1410801 (+ strand)
Length: 2521
Type: CDS
Source: GLEAN
Position: GCSC_113:1410861..1410904 (+ strand)
Length: 44
>GLEAN_3872 class=GenePrediction position=GCSC_113:1407941..1410904 (+ strand)
ATGTTTGTCCGCAAGCGTGGTATGTATCCTTGTCCCTTGCTCCTGAGACTGGCATTGCTACTCTGCCCATTGGCCGCTGG
AACGGGGGTGCCACACGCATACTAACTACTTCTCCAGACGGACGCCAGGAGCGTGTCCAATTCGACAAGATCACGGCTCG
TGTATCACGGCTGTGTTATGGCCTCGACACTGAGCACATTGACCCTGTGGCTATCACCCAAAAGGTCATTTCTGGCGTTT
ATGGCGGCGTGACGACCGCCCAGCTAGACGACCTGGTAAGCCGCAACAGCACTCGCTCCTGTTGCCAAAACCACGTTCTA
ATTCGATTTCTACCCCGCAGGCTGCAGAGACTGCTGCGTACATGACAGTCACCCACCCTGACTATGCGGTCCTCGCTGCT
CGCATTGCGGTTTCCAACCTCCACAAACAGACCAAGAAGCAATGGTCAGCGGTCATCACCGACCTGTACAACTATGTCAA
CCCCAGAAACAACACACTGTCGCCTATGATCTCTAAGGAGACATACGATTGTGTGATGCGCCACAAGGAGGACTTTGATT
CAGCTATTGTCTATGACCGTGACTTCAACTACCAATACTTTGGCTTCAAGACCCTGGAGCGGTCCTACCTGCTCAAGCTG
AACGGTAAGATTGTCGAACGGCCACAGCACATGATCATGCGCGTGGCAGTTGGCATCTGGGGTGACAACGTGGAGCGTGT
TGTTGAGACGTACAACTACATGTCCAACAAGTTCTTCACGCATGCCTCGCCCACCCTCTTCAACGCCGGCACCCCGCAGG
CCCAGATGTCGTCTTGCTTCCTCGTGGATATGAAGGATGACAGCATTGAGGGTATTTATGACACTCTCAAGACCTGCGCC
ATGATCTCCAAGACAGCCGGTGGAATTGGCCTCAATGTCCACCGCATCCGGGCTACTGGCTCCTACATCGCCGGTACAAA
CGGCACGTCCAACGGTATCGTCCCCATGCTCCGTGTCTACAACAACACGGCTCGCTACGTGGACCAGGGCGGAAACAAGC
GCCCTGGTGCTTTCTGCATCTACCTTGAGCCTTGGCACGCCGATGTCTTTGAATTTCTCGACCTGCGCAAGAACCATGGC
AAGGAGGAGATCCGCGCCCGCGATCTGTTCCTGGCCCTCTGGATCCCTGATCTGTTCATGAAGCGTGTGGAGAAGAATGG
CGAGTGGACACTGATGTGCCCCAACGAGTGCCCTGGCATGGCGGACTGCTACGGCGAAGAGTTTGAGGCCCTGTACGAGA
AGTATGAGCGCGAAGGTCGCGGCCGAAAGACGGTCAAGGCCCAGAAGCTCTGGTACGCCATTCTCGAGGCTCAGACGGAG
ACGGGCAATCCGTTCATGCTCTACAAGGACCACTGCAACCGCAAGAGCAACCAGAAGAACCTGGGCACCATCCGCAGCTC
CAACTTGTGCACGGAGATCGTGGAGTACTCTGCCCCAGATGAGGTGGCTGTCTGCAACCTGGCCTCTCTGGCCCTGCCGT
CTTTTGTTGACTACACCAACGAGACGTACGACTTTAAGAAGCTCCATGAGGTTGCACAGCTGGTTGTCCGCAACCTGAAC
CACGTCATTGACGTCAACTACTACCCTGTGCCGGAGGCCAAGAACAGCAACATGCGCCATCGTCCTATCGGTCTGGGTGT
ACAGGGACTGGCAGATGCCTTCCTGGCACTGCGCATGCCCTTTGAGTCGCCTGAGGCCCGTGAGCTCAACAAGCAAATCT
TTGAGACCATCTACCACGCAGCTCTGACCGCGTCGTGCGAGCTGGCCAAGATCGAGGGCACCTATTCGACGTACGAGGGT
TCCCCCGTGTCACAGGGCATTCTGCAACCCGACATGTGGGACGTGAAGCCGTCTGACCTGTGGGACTGGGACTCGCTACG
TCTGAAGATTAAGGAGCACGGTGTGCGCAACAGTCTGCTGGTGGCCCCCATGCCGACAGCGTCAACGTCGCAGATTCTAG
GCAACAACGAGTGCTTCGAGCCGTACACGTCCAACATCTACTCACGCCGTGTGCTGGCGGGCGAGTTCCAGGTGGTCAAC
CCCTGGCTGCTGAAGGATCTCGTTGACATGGGTCTGTGGTCGGACAACATGAAGAACCGCATCATTGCCGAGGGCGGTTC
GATCCAGAACATCCCCAACATCCCAGCCGATATCAAGGCTCTCTACAAGACCGTGTGGGAGATCTCCCAGCGCACGATTG
TGCAGATGGCGGCCGACCGTGGCGCGTTCATCGACCAGTCGCAGTCGCTGAACATCCACATGCGCGAGCCCACCATGGGC
AAGATCACGAGCATGCACTTCACCGGCTGGAAGCTGGGTCTGAAAACGGGAATGTACTACCTGCGTACGCAGGCGGCCGC
CCAGCCCATCCAGTTCACTGTGGATCAGCAGGCACTGCTGGTCGCAGACACCAACTCCGGCCGTGAACGTGGTCTCCGGA
AGCGGGCGCCACCCGGTGGCACTTACGTCAGCTCGCCGTCCGCGATGCCACGGTCCTCGCAGGCCCACGGCGCCAATGGT
GCCAGCAGCGCGTCACTGTCTTCCAACGGCCTCCCGACACCGAGCACATCACCGCCTCCAGCTTCGGGGACTGTCGCGAG
TGCCGGTCGCCCACTAGCATCACCGTCAAAGCCGAAGCCGTTCAAGGCAGACCAGGAGGAGGGCGAGTCGCCAAAGGCGC
TGGCTACCGATCCGATCGGCAAGCCCAATATTGAAGAGCTTGCAGACCCGGCGCTGAACGGTCCCAAGGACCAGAGCGAG
GACCTGGACGAGGACAGCCAGGAACGTGAGCACGACATTTACGCCGACGCAGTCCTTTCCTGTGAGTACATTGCTTGTGA
ACCGTTCTCTTGATGGTACACACACTGACAACCATCACAGGCAGCATTGAGAATCCCGAGGCTTGTGTCATGTGCAGCGG
TTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62