GenePrediction:GLEAN_3873 Details

Name: GLEAN_3873
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1414447..1415745 (+ strand)
Length: 1299
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1414447..1414542 (+ strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_113:1414601..1414810 (+ strand)
Length: 210
Type: CDS
Source: GLEAN
Position: GCSC_113:1414869..1415621 (+ strand)
Length: 753
Type: CDS
Source: GLEAN
Position: GCSC_113:1415677..1415745 (+ strand)
Length: 69
>GLEAN_3873 class=GenePrediction position=GCSC_113:1414447..1415745 (+ strand)
ATGCCATTCAACAACCGTGCTCTCCTCGCCATTGTCGGCTCGGCCTCTGTGGCTGTTGCTGCTTTCAGCCCGCCGTCTGG
TTTCCCCTCGTGCGGTGTAAGTTGCCCGTTATACCACCTCCCACTGACTCGATAGCAAAGCTGACATAAATTAGACTGTT
TGCTTCAACAACATGGTTGCCAAGGCTTCTGAGCTAGGCTGCTCTACCGATGCGTACAGCTGCCTGTGCACCAAGAACGA
CTTCGTCTATGGTATTCGCGACTGTTCGTACGAGTCTTGCAACGACGACTCCGCTGCTGCCACGGCCGTCGCCTACGAGG
TCTCCATCTGCGCCAGTGCTGGTGTGACCATTCCTATTGCGACTGTAAGTGTGAAACAATATGCTATTTTGCCTGGATAT
AGAAATCACTAACGCAACTCAGAGCGGCGCCGCCAGCGCGGGTACGGCCACTGGCACGACCACCGGCACGGCCACTGGAA
GTGCTGCCGGCTCGACTTCCACTGGAACCGAAGGCGGTTCTGGCAGCTCTGGTTCCACAACAGTTGTTGGCGGTGGCTCA
GGTGGCTCGGGCGCTTCGACCTCCGGTGCTGGCTCTGCTGGCTCTGCCACTTCTGGCACTGCTGCTTCCGGCAGCACTAC
GACCGCAGCCTCTGGCTCTGGTGCTTCCGGCTCTTCCACGACTGCCATCGGCGGCGCTGGCTCTGGCGCCTCCGGCTCTG
GCGCCTCCGGCTCTGGTGCCTCTGGCAGCGGTGCTTCTGCTACTAGCGGTGCTGGTGCTTCTGGATCTGGTGCCTCTGGC
AGCGGTGCTTCTACTACCGGTGGCGCTGGTGCTTCTGGCTCTGGTGCCTCTGGCAGCGGTGCTTCTGCTACTGGCGGTGC
TGGTGCTTCTGGCTCTGGTGCTTCTGGCAGCGGTGCCTCTGCTACCAGTGGTGCAGGCGCTTCTGGCTCTGGTGCCTCTG
CTACTGGCTCTGGTGCCTCTGCTACTGGCTCTGGTGCTAGTGCTTCTGCTACTGGTGCCGGCGCTGGCTCTGGTGCTTCT
GGCTCTGGTAGCGGCGCTTCTGCCACCACTGGTGACAAGACCGACAGCACCACTCTCGCTACCGCCACTAAGAGCAGCTC
TGGGACTGGTAGCTCGGCATCCTCGACTGCTTCCACCTCTACGAGCAAGGGCTTCGTAAGTTTACTGTTACTTGAAACGT
GCCGATTGAGCTTGGCTAACCATGTAATAGGCTGCTCACATGACTGCTGCTCCTGTCGGCCTCATGGCTGCTGCTGGTGT
CGCGGCTCTCCTGCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62