GenePrediction:GLEAN_3875 Details

Name: GLEAN_3875
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1423573..1425242 (+ strand)
Length: 1670
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1423573..1423649 (+ strand)
Length: 77
Type: CDS
Source: GLEAN
Position: GCSC_113:1423705..1424857 (+ strand)
Length: 1153
Type: CDS
Source: GLEAN
Position: GCSC_113:1424928..1425242 (+ strand)
Length: 315
>GLEAN_3875 class=GenePrediction position=GCSC_113:1423573..1425242 (+ strand)
ATGACGCCCAAAAGCTTCGCCGTTCCGACCTATGTCAAGATGTGCATCCTCACATCACTGATAGGTTTCTTGTTTGGGTA
CGTTTTCTTCTGGACTGCCGACGTCCTCTTATCCACACTCACACCTTCGCAGATACGACACGGGAAGCATCGGCCCCGTC
ACGACCATGGCAGAATTCAAGGCCGTTATGGGGGACTTTTCCGACACCATTCGCGGCGTCGTGGTTTCGTCGTCCCTCAT
CACCGGTGCCGCGTCCGCGTCCATTGCCGGCATCCTCGCCGACAGGTACGGCCGCATCCGCATCTCGGCTCTGGGGGCCT
GCATCGACGGTGTCGGTGTCGCCATTGAGTGTGCCAGCCCTGTGCTTGGCGTCTTCATCCTCGGCCGCCTGATCAAAGGC
ATCGGTGCCGGCCTCTATCTCAGCACCATCTACGTGCAGGTCTCCGAGATGTCGCCGGCACGCTACCGTGGCGTGTTGAC
CTCTATCCCGCAATTCATCATCGTCATCGGCCTCATCGCCGGCTACTTTGTCTGCTACGGCACCTCCAACATCAAGGACT
CGTCTCTGGCCTGGCGCCTGCCTCTGGCCATCGCTTCCTTCGCCGCTTTTGTCCTCGCCGTCGCCGTCTGCTTCGTCCCC
CCTTCGCCGCGCTGGTTTCTCACCAAGGGCGAGCTCGAAAAAGCCCGCGTCGTGGTTCAACGGCTCGGCTTCGGCCAGGC
CGAGCAGGACGAGCTGCTCGCCCAACAACAGGATGAGATGCCGGCCGATGCGGTCGAGCCGTCACTGGCCACTAGCATCG
TCCACATGTTCCGTGACTTCCGTGAGGCCTTCCGGCAACCCTACCGCTCCCGCACCATATTCGGCTGCCTCATCATGGCC
ATGCAGCAGTTCAGCGGCATCGACGGCGTCCTATACTATGCCCCGTTACTCTTCCAAAACGCCGGCCTCAAGTCGACCGA
GGCGTCCTTCCTCGCTTCGGGCGTGTCTGGCCTCGTCATCTTCGCCATCACTATCCCTGCTACCCTGCTGGCTGACCACT
GGGGCCGCCGGACAGCCTCCATCCTTGGCGGCGTGCTCGTCTCTGTCCTGATGCTGCTCATGGGCTCCCTCTACGCCGCC
GACCAGGTGCACGGCGCCGGCCGCTGGGTAGTCATCGTCTGCATATACCTGTTCGCCATCTCCTTCAACGGCACCTGGGG
TATCGTCTTCCGTATCTACCTAGTCGAGAGCCTGCCGAGAAAGACCCGCTCGAGTGCGTCTTCTTTGGCGCAGAGCGCAA
ACTGGGTAAGAGTTTTGGTCCCTTTGCCTTTCCCCCCCTCCTGTTCAGTAGTTGAATATACTGACCATCCCACAGGTGGC
CAACTACATCGTTGCACTTGTCACGCCCGTTCTTCTCTCAGCGTCGACAAGCGGGGCATATTTCTTTTTCGGGGGTATGA
CGGTGATCTGCACGGTCATTGTAACCCTATACATGGTCGAAACAAGGGGAGCTACCTTGGAAGCTATCGAGCAGGCATAC
ACGGATAGGATGGCGAGCAAAGCCTTGAAGCGCAAGGCTGAAAAGACCACGATTGAGACGAACAGTGCTGAGGCCAGCAG
CTTTGAATTGGGGAGGACGGAAAAGAAAGAGTTCACAACCGTTTCTGAGACGTTTGTTGAGAGCGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62