GenePrediction:GLEAN_3877 Details

Name: GLEAN_3877
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1427809..1429448 (+ strand)
Length: 1640
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1427809..1428005 (+ strand)
Length: 197
Type: CDS
Source: GLEAN
Position: GCSC_113:1428069..1428096 (+ strand)
Length: 28
Type: CDS
Source: GLEAN
Position: GCSC_113:1428170..1428698 (+ strand)
Length: 529
Type: CDS
Source: GLEAN
Position: GCSC_113:1428763..1429448 (+ strand)
Length: 686
>GLEAN_3877 class=GenePrediction position=GCSC_113:1427809..1429448 (+ strand)
ATGGCCGCGTCCTCAGTCCAGAACCCTGCAGCTGTTACCGAGTCTAAAACCTCTAAGAAGAAGAAGGCCAAGGCTGAGCG
TACAGAGTCACCTGCTCCGACCCACGTTGCCACCTCCGAAAAGGATGTCTCTGTCAGCCCAGCAGATGCCACTGGCGAGG
AGCTTTCCGAGCCTGCTTACCTTCGTGAGATAGCCAAGTATGCAGATCCCCCAGAGCCTGTTTGTTTTTGCGGGGAAGCG
TAGTGCTAACCATGTTGCAGGAACATTCGCAACGTCAACAAGAAGATTGTAAGTCCCGATAATCCGTGACAACCCACGGC
TGATTCTTTCGCAACACGGTAAATGCTAACCTTGAACGCAGACCAACGCTTCCAAGACTGACGGTCTTATTTTCGAGAAC
AAGGACAAGACCCTGGAGGAGCTTGTGGCCCTCAAGATAATCAATGCGGATCAAAAGGCGCAGCACCTGAAGAAGCCCGC
CCTTCTGGCCCAACTGGCTCAGTTGGAGGAGCAGTATGCCCAGCTCAAGAAGATTGACTCGGACTACCGCCTGCGCCTGG
TTACCGACAAGGCCGAGGTCACCAAGACGCTTACCCAGAAGTTCGAGAAGGAGAAGGCCGGGGCCGTTCTCGCAGCCACG
GAGACGGCCGCCGCCGATGCTGAGAAGCACCTCCAAGATTCCCTTCTGACCATCTCACAGTTTCTTCGCCTGGCTGCGGC
TCGCCGTGCAGACGACCAGAACTCACAACTGGACGAGAACCTTGCTCTGGAGGGCGTGCTTCTGCAGGTGTACTCTGGCG
ACGAGAACGGCGTTGCCACCATGCTGAAGCTCGTGCAAGGCGTGGAAGAGACAACAAAGAGCGTGACCAGCGACCCTCTG
CAGACTACTTGTAAGTGCTTCGCTGTGGCTTGCTCGTTACCATTGGTCAAAGCTAGAATCTTAACAATGCGAAGATGCCC
AGGTCAAGGCTGTCGCGGCCGCCCATGCCATTCCGCTGTACCAGGCCGAGCCTGTCGAGGAGGTCGTTGCCGAAGAGACC
CACGAAGTCCAGTCTGACCCGACCATTGCACATGCTAGCCTGACCGAAATCGAGGCTGGCGAGGACGCTTCCCTGGCAGA
GGTCGCACAGCTGACCAACGGCGATGCCAGCCACAGCCAGGCTGTCGAGGCTCCCGGGCACATTGCCAACGCGGACGTGG
ATGACAGCGCTGCCAATGCTGCGGGTGAGAGCCAGTGGGACACAAGCGCCAACCAGTCCAAGGACTTGAGCATGTCCCAG
GAGTGGGTCGAGGTGCCCCGGGACCCGGCGGAGACGGAGACCGGCCTGGAGGCAACGCCAGAAGAAGGAGGCAACAAGCA
GTCCTGGGCCGACGAGCAGCCCGAGAACCCGCCTGAGCCGGTGAACACTGCGCCTGCGGTAGCACAGGCCGACCCCAACG
ACGGTTTCCACCAGGTGCAGCGGCACAACCGTGGCCGCAGCGAGCGGGACAACAACTGGCGTGGCCGTGGTGGTGGCTTC
CGTGGTGGTCGCGGTCGTGGTGGTGACGGCCGTGGTCGTGGCCGTGGCCGCGGTGGTAACGGTGGTGGCAACGGCAATTT
TGGGTACCGCGGCCCTCGCCGGACTGAGGAGGCATCTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62