GenePrediction:GLEAN_3878 Details

Name: GLEAN_3878
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1430586..1431807 (+ strand)
Length: 1222
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1430586..1430779 (+ strand)
Length: 194
Type: CDS
Source: GLEAN
Position: GCSC_113:1430934..1431009 (+ strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_113:1431088..1431807 (+ strand)
Length: 720
>GLEAN_3878 class=GenePrediction position=GCSC_113:1430586..1431807 (+ strand)
ATGCCAGCCAGTGACCCTGTACACACTCGTCCAGATGTGCCCTTCCGCCTGGCCGCACCGCTCACGCAAAGCGTCTCTTC
TGGCGCTTTTTGCTATCCAGGCTCCGGCGTTGGCGTGTCTGCTGCTGCGGCTGTGGGTGCGGCGTCAACAGTTGCAGAGG
GCAGACGACTATCTCACAATGGTGGTGGCAGCACGTATTCCCCTTGCCATGTCTCTTCTCTCCTTTCTGGGAGGTCGATA
CTGACAGCTAGCCTAGCCTCTGTTTGTGGCCTTTCTCATCACCGGGCAATACGGTATGCGGTCTTGGATCTGTCCACAAT
GATACAAATGATGCGTTGCCTGACACAGGCTTCTAGCCGCAGTGGTCGGGTTCGGTGTCGACATCTGGACCCTGTCGCCA
GGTGCCATTGAAAAAGCCTTGCTGGTAGGTTGGGAGTTTTGGGAGGGAGGGTGGAAAGAGGGATAACAGTAAATCGGAAG
GAGAATATATGCTGACATGCAGGCCTTTTACATTGCTGAGATCCTGTACCTGGTCATTCTCACACTGGCTCGACTGTCGG
TATTGTGCCTGTATCTGCACCTTTTTGCACCACTCCGGACTTCCTGCAGAGGCGGCGACAGCCGTGGAGAGGACGGCACT
GGAAATGTTGGCTTGAACATGGACGCCGCCCCAGCGACGTCTCCCTCATGGGGTCGCTGCGGCTTCCAGATTGCGGCGCT
GGCTATTGCGGTCTGGCTGGTCATTGCAGGCACCGTTTTCCTGTTTCTGGACGTCTTCCAGTGCTGGCCAGTCGACACTG
TCTGGCGGTTTGATTTTCTGTCGTCTTCTTCGCCTCCGTCTCCGCGCTGCCTTCCCGTCGGCACCGTCGCCTGTGCCGCT
GCCGCCTGTGGCATTGCCCAAGACGCGGTCATTCTCGTGCTGCCGCTTCCAGAACTGGTGCAGTTATGGCGGCGGCTGCC
GTCGGCACCGGCACCGGTGGCAACAGCCACGACGGCGGTCATGTTCAGCCTTAGCGTGGTCGTGCTGGCCACCAGCGCCG
TGCGGCTGCGATTCCTCGTGCGCTTTGGCCGGTCGGCCAACCCAACGTGGGACGACACCGACAGCCTGGTGTGGTCCGGG
GTCGAGGTGTCGGCGACGGTGGTGGTGGCGAGCGTGCCTGCAATCCGGGCAGCTGTGCGGCAGTGGTGGAAGAGGAGGGG
GGGCGGCGGCCCTGGTGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62