GenePrediction:GLEAN_3879 Details

Name: GLEAN_3879
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1434206..1435752 (+ strand)
Length: 1547
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1434206..1434251 (+ strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_113:1434317..1434542 (+ strand)
Length: 226
Type: CDS
Source: GLEAN
Position: GCSC_113:1434603..1434652 (+ strand)
Length: 50
Type: CDS
Source: GLEAN
Position: GCSC_113:1434710..1435752 (+ strand)
Length: 1043
>GLEAN_3879 class=GenePrediction position=GCSC_113:1434206..1435752 (+ strand)
ATGTCCAACGTCCCGAGCGAGCCTGAGTTTGAACAGGCCTACAACGGTAAGAGAATATGTGTGATAGATTGGCGAGCTAG
AGTGGTGGGAATTGCTGCTGATTCTCTCCAGAGCTTGTCAGCACCCTGGAGAACAGCACGCTGTTCCAGAAGAGCCCCGA
GTACCGCATCGCCCTCAAGGTCGCCTCCATCCCCGAACGCATCATCCAGTTCCGTGTCGTGTGGGAGAACGACAAGGGCG
AGCTGCAGGTGAACCGTGGCTACCGCGTCCAGTTCAACTCGGCCCTCGGCCCCTACAAGGGCGGCCTGCGCTTCCACCCC
AGCGTGAACCTGTCCATGTAAGGAATGGAACGGCAGGTTGTGTGTCCTGGACATTGTCTGACATCTTTGCGGCACAGCCT
CAAGTTCCTCGGCTTCGAGCAGGTCTTCAAGAATGCCCTCACCGGCTGTAAGTTGGCTCTCTGTCTTCCTCATTCTGTCT
GTTTCACTCGCTGACATGATCTAGTGAGCATGGGTGGTGGCAAGGGTGGTGCCGACTTCGACCCTAAGGGCAAGAGTGAC
GGCGAGATCCGCCGCTTCTGTGTGGCTTTTATGCGCGAGCTGTCCCGCCACATCGGCGCCGACACCGACGTGCCGGCTGG
CGACATTGGGGTGTCTGGCCGCGAGATCGGTTGGCTGTTTGGCACCTACCGGGCGGCCCGCAACAAGTTTGAGGGCGTGC
TGACCGGCAAGGGCCTCGCCTGGGGCGGCAGCCTGATCCGCCCCGAAGCCACCGGCTACGGCCTCGTATACTACGTCGGT
CACATGCTGCAGTACGCCGGCGCGGGTGACTTCAAGGGCAAGCGCGTGGCCGTTTCCGGCTCCGGCAATGTGGCCCAGTA
CGCGGTCTTGAAGCTGATCGAGCTCGGCGCCACGGTTGTCTCGGTGTCCGACTCCAAGGGCGCCATCGTGGCCAAGGAGG
GCAGCTCCGTCACGGCTGCCGATATCGCCACCATTGCCGACCTCAAGGTCGCCCGCAAGGCCCTGACTGAATTCAGCGTC
GAGGACCGCTTCACCTATCTCGAGGGCGCCCGCCCGTGGGTCCACGTCGGCAAGATCGACATCGCCCTTCCGTGTGCGAC
CCAGAACGAGGTCAGCGGCGAGGAGGCCAAGGCCTTGCTGGCTGCTGGCGCCAAATTCGTCGCCGAGGGCTCCAACATGG
GCTGCACCCAGGACGCTATCGACGTCTTCGAGGCCGACCGCAAAGCCAAGAAGACCGCCGCTGTCTGGTACGCGCCCGGC
AAGGCCTCCAACTGCGGCGGCGTCGCCGTCAGCGGCCTCGAGATGGCCCAGAACAGCCAGCGCCTCAGCTGGGCCGAGGA
GGAGGTCGACAACAAGCTCAAGGACATTATGAAGAACGCGTTCGAGAACGGCCTGAACACGGCCAAAGAGTACGTCGAGG
CTGCCGACGGCGAGCTCCCGTCGCTGGTCGCCGGCTCCAACATTGCCGGCTTCGTCAAGGTCGCTCGTGCTATGCACGAC
CAGGGCGACTGGTGGTCCACGCAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62