GenePrediction:GLEAN_387 Details

Name: GLEAN_387
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1471732..1473182 (+ strand)
Length: 1451
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1471732..1472850 (+ strand)
Length: 1119
Type: CDS
Source: GLEAN
Position: GCSC_167:1472955..1473182 (+ strand)
Length: 228
>GLEAN_387 class=GenePrediction position=GCSC_167:1471732..1473182 (+ strand)
ATGCTGAACAGAAGACGGCTGCTCGTGCAGCCTAATCGAAGGCGACGAGCTGCAGATGGATCAAGCGATTCCTTGCAACC
CCCAATACCACCACCCGAGCTCGACGACCTGCCCCTCTACGAGCCGCCCACGCTGCCACTGGACGATGCTGCAGTTCGCT
CTATGGCCGAGCTGGCCAATAACCGCGCACTAATGCGCATGTACGACGCGCAACTGAAGAAGTCAGCAGAGTATTTACGA
GAGGCTGTTGGCAGTATCAACGATCTGTATACTGAGCGAAAGTCGGAGCTGCAGCGCATTTCAGACCGCCGACACGAGCG
GGGCGCAGACCAACCGTCTAAGATTGAGACGGAGGTCATCAAGTCGGTAGACAAGCTGGCCACAGACGTGCCTCCGATGA
CCGTGGATATCGAGCGCTGTGCACGCTTGGTCATCGATATGCAGGCCGAACTCGAGGACGAACGCGAGGCGCTCATGTGG
ACGAACGAGCAGGTCTGCGCCCGCCAGCAGGAGGACCGACAGCGGGCTCGCCTGCAGGAGCAACGGCAGAACCAGCGGCA
AGAGCGATTAGCAGCCGCCATCCAGCGGCGAGCTGCAGGAGCCGCAAGCGGCCTCAAAGGAGAATGGGAAGACGAAGAGG
GTGGCTCGCAGCCGCTGGAGGAGGACGAGGACGACATCGACACCCAGGACGAGAAGTCGTGTCCGACAGCTGTGACCGAT
GTGCTGCGGCAGGCCCGAAAGAACCGAGCCGCCGAGTACGCACAGATGGATGCCTTCCGCAGGTATGGTCTTAACAACGA
CTACGTCACCTTCAAGCAGATTTGGCACGAAGCCATACACCCGGACGGCGACGCTTTTCTGCCTGACGCATCCGCCTGGT
TCGACGCCGACGGGCAACCTGTGGAGTATGGGCCAGACGGTGTGGTGGGGGCTGGCGGCGATGACGATGACGACCTCATC
GTGGCCCGGGAGGTCATCAGCTTCAAGTGTCCCCTGATGCTCAGGACAATGGTGGACCCCTACAAGAGCCGACTTTGCAG
CCATACGTTCGAGAAGCAAGGAATCATGGAGTATCTGCAACAAGGCTCGAAAAAGTGCCCGCAGACTGGCTGTGACAAGG
TAACGAGCCATCCCGGTTGCGAGGTTGCGAATTTTAAAGCCTCTCCCCCCTCTCTCCCCACTTTTCCATACTTTTCATGT
CACTGACGATGACTCGCTTGCAGACCCTCTCCAAGGACGACCTGGTACCGGACAACGTAATGCGTCGCAGGATCGAACGT
GCCGAGCAAATAGCACAGCGCAACGAAGCGGATGCCACGTCAGATGTGGAGGCCGAGGAGGTAAACGGTGGCGACGCTGC
AGATGACGATTCAGAAGCAGGTGATCCGAGCGTGGTAGAGGGCCATGCTCGAGAGGTCAAGCGAGAGCGGTTTGCGCGGT
TACAGCGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62