GenePrediction:GLEAN_3880 Details

Name: GLEAN_3880
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1438109..1442460 (+ strand)
Length: 4352
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1438109..1438784 (+ strand)
Length: 676
Type: CDS
Source: GLEAN
Position: GCSC_113:1438853..1438966 (+ strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_113:1439037..1440120 (+ strand)
Length: 1084
Type: CDS
Source: GLEAN
Position: GCSC_113:1440180..1442460 (+ strand)
Length: 2281
>GLEAN_3880 class=GenePrediction position=GCSC_113:1438109..1442460 (+ strand)
ATGTCGGTGGAACAGCTCGGTGTTTCTGCAGACATGCCGAACCATGGTCAGCTACGGTTTGGCCAGGTGCAGAAAGACAA
TGGCACTGATAATGCCTATGCCCACACCCTCAGCGGCAGTCTACAATTGCCTACTACAATGTCAATCCGAGCAATGCACA
CAAAGAAGAGCTCCCTTGAGGATGAGGGATCAAGCTCGGTCCCAGCGCTGAGCTCGTCGACCACTGACTCTTCCTCGGAC
TCTGATTTATCCTCGGCCGACACAATATATACCACAAACAAGTCCAAGAACAAGGTCACAGGGATATGGCCGGCACCATC
TACCGACTCGTCCAGCAATACGGACGGTTCGGATACCAAAAAGTACCCGCGGATTAGCCGGGCAGTTGAGTTAATGCGAA
GCTCGTACGACTGTGTTGTCATTGGTTCTGGCTATGGCGGCGGTGTTGCTGCCTCACGCATGGCACGTGCCGGGCAGAGT
GTCTGCCTGCTGGAGCTGGGCAAAGAACGGTGGCCTGGAGAGTATCCCTCCAGCACACTGGACTCATTCAAGGACCTGCA
CTGCTCTGGCGATCTGGCGCCGTCTTCCTTGGGTGGCGTGGATGTCAGCACCGGTCAGCCGACCGGAATGTACCATTTGA
TCTTTGGACAAGGACAAAATGCGGTTGTGGCTAATGGTACGTTCAGCAAAGGTGTTAGTCGGAAGAGCGCTCTTTTTGCT
AATAATATTCTCGAACATTTGCAGGCCTTGGAGGCACCAGTCTGATCAATGCGAACGTATTCTTGCGTGCCGACCCAGAT
ACAATGGCGATGAAAGCATGGCCGAAAGAGCTGCGCAAAGAAAACGCGCTGGACGAATGTAAGATGCGACTGGCTTGTTT
CCGTACCATTTGCATCACATATTCTCTTGGCTAACTAAAGTACGATAGACTATGACAGGGTGGAGAGTGTGCTCGAGCCT
GAGGCATACCCAGATGACTGGCCGACACTTCCTAAGCTAGAGCTGTTGAAGAAGCAGGCTTCCGCTCTCCAGATGGAGGA
CAAGTTCAGCAAAGTCAAGCAGACGACGCGGTTCCGAAACGGCCCCAACAGCTGCGGCGTGGAAATGACGGCCTCTTCTC
TCACAGGCCAAGACTGCACTGGATTGAACGACGGGTCCAAGACGACGACTCTGGTCACGTATCTGGCGGATGCTTGGAAT
TGGGGTGCCGAGATGTTCTGCGAGTGCGAAGTACGCTACGTCGAGAAGGTCACAGATGAGCGCGGCGGCTACCGCGTCTA
TTTTGCCTGGCACGGACGCAACCGCGGACGCTTCAAGGCGGACATGTACAGCGATCTCATGTGGGTGTACGCGCGCGATG
CCGTGTTCCTGGGAGCTGGCTCCCTCGGCACGACGGAGATCCTGCTGCGCAGCAAAGCCATGGGCCTGGGACTCAGCGAC
AAGGTGGGCCAGGACATGAGTGGAAATGGAGACATGCTGGCGTTTGGGTACAACACGGACCAGACGGTCGATGCGATGGG
TCGGGAAAAGCCATTGCCGTACCGTCCGATCGGACCGACAATTACCGGCGTGATCGACAACAGAGACGGGCACAAAAACC
CTTTGGACGGGTATGTGATTGAAGAAGGTGCGGTGCCTCACGCACTCGCGGGCCTGCTGCAGACCATGATCGAGCTGATG
CCAGGTTCGGTGGCGTCCAAGCACACCTCTGTGATGGAGCGTGCGCGGGAAAGTCTTGCCAGCGTGGGCAGCCAGCTGCT
AGGCCCATACTTCCGTGACGGGGCGGTGGAAAGGACGCAAATTTATCTGGTGATGTCCCACGACAGTAACCAGGCGGTGC
TGTGCCTCCGTGACGACAAGCCGGTGCTCGAGTTTTTGGGTGTCGGCCGCAGCGAACATGTCAAACACATCAATGGCGTC
CTCGCCAAGGCGACGGAAGCAGTAGGCGGCACGCTTGTGGGCAGTCCATTCTCTGCGCTGATGGGACAGGAGATCACGGT
TCACCCGATTGGGTAAGTTGATTGCTTGATCCTGGAGGAGGAGAAGCAGGATCCGATGGCTAACAAAGCAGGGGTGCATC
CATGGCACCAGACGGCAGTGGAGTCTCGGGAGCGACGGATCATATGGGCCGACTGTTTGCAGGAAACGGCAGCGATGTGC
ACGATGGTCTGATCGTGACGGATGGCGCGGCTATCCCGACGGCACTGGGTGTCAACCCGCTGGCGACGATTGCGGCTCTC
GCTGAGCGGTCGGTGCAGCAGTATGCAACATCGCGAGGGCTGCAGATTCGGACAGAGAAGAACGGGGTCCTGAATCTCTT
CGGCAAGCCGGCACACCAAGCCGATGACTACAACAACAGCCACAAGGCCTTCTCGACCGCTTACGAACAGGCTCAGGAAC
AGGAAGATGCCGACGAGGAGAAACAGACGAAGGTGGCAGACGGGATTATCAGGCGGGCAGAGTCAGAGGACGCCAGTGGG
TTTGGATTCACGGAGGTCATGTCTGGCTTCCTCCACAGCGGCGACATCAGCGGCAGCATGGCGACAGACGAGAGGCAGGC
ATACGAGCTGGGCTACCGGACGGGCAAGAGCCTGTGCGAGAGCGCACGGTTCTTCCTGACGGTGCAGAGCTTCGACACGG
AGGAGATGGTCAGCAGCACCGGCCACGAGGCAATGCTGACGGGAACATTTGTGTGCCCGACACTGCGCGGATCGCCGTTC
ATGGTGCAGCGCGGCGTCTTCCGGCTGTTTGCGGTCGACAGCAGGGCGCCGGGGACGCGCAACCTGACATACGACTTTGA
CCTGCACGGCACGGACGGACGGACGCTGCACTTCCACGGCTACAAGGTGGTGGACGCATCGGTGGCGCTGGCGCCGCTGC
AGTTCTGGCGGGCGACAACGACGCTCTTCGTGACGGTGACGAAGGAGGAGGTGGTGGTGGCCAAGGGGATGATGCACATT
GGAGCAGCAGAGTTTGCGTCCGAAGTGATGACGATGACGCCGACAGGAAGTCGACTGCTGCAACGGCTGGCGAGCACGAA
CAGCTTCCTGTCATACTTTGCACGACAGTCACTGGGGCTGCTTCTCGGACCGCTGGCACGGCTGCAATATCCAAAAGCGA
CAGTGACGGGATTCAGCAACGATACGACACCGACGCGAGTGTGGACAGACATCCGGGCGTCTGACGGCGTGCACACGCGC
ATGTGCATGTGGGAGCCACTAGCAGCGTACGTGCCTCGCGGAGCAGACGGACAGGCCGGCGTGGTGCACAACCTGTTCAT
GGTGCCGGGAGCGGCGGTGGACCAGCAGATCTTTGCGACGCCAACGATCCCGTTCAACGCGGTCAACTACTTCAACCGGG
CAGGCTATCGCGTGTTTGTGACGGTGCCGCGGATTGGACAGGTGAAGGAGGCCGAGAAGGGCTGGACGACATATGATGCA
CGACTGGACATCCGGGCGTGTTTGGAGCACATCCGGCGCGAGTACGGTGGTGGAAAGACGGGGGGGGACGAGACGGGACA
GCCGAGCCCGATATACACGATTGCCCACTGCATGGGATCAGTGGCTTTGTCAACAGGACTCCTGGACGGAACGATCCCGG
CGTCCTGGCTGCTGGGCCTGAGCTGCTCGCAGGTCTTCATGAACCCGATCTGGGCGACGTCGAACATGGCCAAGGCGCGA
GCAGGACCGGTGCCGATGGACCGAGTCTACCGGCTGCTCGCAGGGCCGTGGTTCAGCTGCTCGACCAGTACCGAGGACTC
GTTGGTGCAGCGGACACTCAACCAGGCGCTACGGCTGATCAGCGCGAGCCGGCGGGCGGAAACGTGCAGCAGCGCGTCCT
GCCACCGGGTCAGCCTCGTCTTTGGGCGGTGCTGGAACCATGCGAACATGAACGAGGCGACGCACCGGCAGATCGATCGC
TTCTTCGGCGGCGTGCATATGCGCATGTTGCAGCTGCTGATGCGCCAAGGCAGCCAAGGTCACGTGATGACCAATGCGCC
CTACTTTGCTATTCTCGACACGCCCGCCAACGTGGCCCGGCTGCGTGGCCTGCCAATCTTCCTGTTTGTCGGCAGTGACA
ACGTGGTGCTGTCGCCGCTGGCGACCGAGACGACGTACGAGGTGTTGTGCGATACGTTTGGCGGCGACGCGGCCGAGGCG
CAGTACGGCCGCCGTGTCATTCCGGGCTACGGCCATCTTGACTGCTGGATGGGGCGTCAGGCCTGGCGCGACGTGTATCC
GGTCGTGCGCGCCGAGGTCGACCGGGTCGTGCACGGGGATGGCTACCGCTTCCGGGAGCCGGACGCGACTGTCTGTCGGT
TTACGCGGATGATGGAGGCGGGTGAATTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62