GenePrediction:GLEAN_3881 Details

Name: GLEAN_3881
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1452739..1453583 (+ strand)
Length: 845
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1452739..1452756 (+ strand)
Length: 18
Type: CDS
Source: GLEAN
Position: GCSC_113:1452980..1453284 (+ strand)
Length: 305
Type: CDS
Source: GLEAN
Position: GCSC_113:1453421..1453583 (+ strand)
Length: 163
>GLEAN_3881 class=GenePrediction position=GCSC_113:1452739..1453583 (+ strand)
ATGGACCGCATCAAGGAGGTTAGTACAAGCCTGAGCTCCAATCGTGGACACCCCTCCATCCATCTTCCCTTCCCCCCTAC
TCTGGCCACCTGTCACAGAGACCGGCGTCATTCCTCATAGTCTCCCTTTCCCGAGCTGTACTCTGCCGTCGAGCCGACTA
CGGCCATAGCCCCCCAAGGGAATACGGAATGGGGCAAGATGCGTTGAACTCTTGTGCTGACCGCCCTCTTCCGGCCAACA
GAAAATGAACCAGCTTCGCCTGGAGGCGGACGAATCGCTGGCCAAGAACGAGGAGCTCCAGGCCAAGCTCAAGACGCTCG
AGCAAGAGGGTCTTTCCAAGGAGCAGGAGATCACCTCGTTGTCGCACAAAAACGGCCTGCTCGAAACGGAGGTGCAGAAG
CTCGAGACCGCTATCGCCGACTACAAGAAGGCCGCCGATGAGGGCCTCCAGCATGGCACACAGAACGAGACCCTGACCCG
GAGACTGCAACTTCTCGAGGAGGAGGCAGAGAACGCTGACAAGACGCTCCGCGAGGCAAACGAGAAGTATGTCAAACCTC
CGCGTGTCGTCACCTCCACTTTCTTCCAGCACGCTCAGAAATACCCACTGTCCACCAAAGGTGACCCCTTTTCTTCTTCC
GAACTCTCCTTACTGACCCCTCCCTCTTCTCCCTTCCTACAGGCTGCGGCAGACTGACGTCAAGGCCGGCCACTTCGAGC
GAAAAGTCCAGGCACTCGAGGCCGAGCGCGACCAATGGGAGGCCAAGTACGAGGAGATGGCCAAGAAGTACGCCACCGTC
CAGAAGGAGCTGGAGGAGTTCCAGGTCGAGATGGGCAACATTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62