GenePrediction:GLEAN_3882 Details

Name: GLEAN_3882
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1455134..1456150 (+ strand)
Length: 1017
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1455134..1455225 (+ strand)
Length: 92
Type: CDS
Source: GLEAN
Position: GCSC_113:1455326..1455714 (+ strand)
Length: 389
Type: CDS
Source: GLEAN
Position: GCSC_113:1455774..1456150 (+ strand)
Length: 377
>GLEAN_3882 class=GenePrediction position=GCSC_113:1455134..1456150 (+ strand)
ATGCGTTCTTCCATCTTCGCAAGCCTTCTGGCTGCAGGCTCCGCGCACGCCTTCTCAGACTCGTCCCCCTTTCTCCTCTT
CTCCACGGCCAAGTAAGGTGCTTTCCTGCGGTTAAATCGCACTCAGCCTTTGGACCACGATACTCTGCATACAAATATGT
CTTGCACGTTTCTGATGCTTGCATCCCCACAGGTTCCCGTCCGCGCATCAGCCATCGCAGCTGCAGACCAGCTCCAGTGT
GCTCTCTGCGGCGAAAGACATCCTCAGCCTGTGCCCGACGACAAACTATCTTCTAGTTTCGCAAGCCAACGCTCACGCAT
CCGACTTAGATGGCCCGGAAGAATGTGGCGTGCACAGGATTCGCTCCGCAGTGACCAGTGATGCTGTGCAAGGCCGGTAT
ACCGTGGCAGAGGTTGTCAATGCTGCCGTCGGAAATATGTCCTTTGACAGCTTCTCTGATCACATCAAGAAGTCGTGTCT
AGGAAAGGGTGCCCGAGAGGCAATTATCCGGCAGCTATCTCTGACGCCCCTGCCGACATCCCGAAGATGCAAGGATCGTG
TCGAGACCATGGACGATAATGGTAAGTGATGAGGAAAAAACAGTTTAGGAAATGCTTCGCTAACAACATGGCCATGACAG
ACTACGCTCTCGGCAACATTCTTCAGGAGAAACTGCCCTCAGGCGATTACACCGTTCTATTCTTCTCGACTCCTCATGAG
AGCAGGCCGTACGAAGTAGATTTCGAAAACCCATCGCAGATCCAGCTCAGCAAGCGGATCGCCGAGCCTGCGCGTGCTGT
TCATCGCAGGGCCGCTGCGGACGCAAACTGGCCGAAGGATGCCGCCCTTTTCGATAAGTACCAGTTCTTCACGCCTGGTA
TCTTCATGGGCCTCTCTACATTCTTCGTGCTGCTTAGCATCTTGTATGTCGGTCTTGCAGCATTGTCCAGCCTCGAGGTT
TCGTATGGTGCTTTCGACAAGGACATTAGCCCTACTGCTCAGAAGAAGCAGAACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62