GenePrediction:GLEAN_3883 Details

Name: GLEAN_3883
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1470695..1472870 (+ strand)
Length: 2176
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1470695..1471099 (+ strand)
Length: 405
Type: CDS
Source: GLEAN
Position: GCSC_113:1471176..1472870 (+ strand)
Length: 1695
>GLEAN_3883 class=GenePrediction position=GCSC_113:1470695..1472870 (+ strand)
ATGGGAAAGTCACGACGCAATAGGGCCGGTGCATCTAACCGCTCCGATCCAGTGGGCGGCCGTCCTAGGACAGTCAAGGA
GCCTTCTGACCCACAGCTGGCGGCTCTCCGTAACGACAAGATCTTGCCAGTGGTGAAGGATCTCAGAAGCGCCGATCCTA
AGACACGCACAACAGCAGCAGGCGCTATTGCCAACATCGTCGAGGACTCAAAATGCCGGAAGTTGCTGCTCCGGGAGCAG
ATCGTGCATATCGTCCTTACTGAGACGCTGGCTGACTCCAGCATCGAGAGCAGGGCCGCCGGCTGGGAAATTCTCAACGT
GCTGGCACAGAATGAAGAAAGCGATTTCTGTGTGCATCTGTTCCGTTGCGACGTACTGACACCTGCAGAACATGCTCTGA
GCCAGGTAAGGATGCTGCTTAGAATTCGAGCTTGCCTTGCAAACACCTATAGCCCACTAACACATTGCCATCCTGTGTCA
GGTTCTTGAAACTCTGCAGTCTACGGAGACACCATTCTCCAAGTTGACCAAGGCGCAGCAGGAATTTGTGTGGAGAATCA
CCTTGTCCATCATTGACCTGGTTGGGCAGCTGGCTGAAGCACGGAGCGAGATTCTCGAGGCGGTAACAGGCAATGCTGCC
ATAACACGAGCATTCTTTGCGTTGGTGTGCACCTCAGCGGCACCATTCGAAATCCACTGGGCTGCTGTGACGTGCCTTGC
TCGGCTGTGCGACGACCAGCGTGCCCTCTCACAAGCCGTAGTCGATGACCAGGTAAGCGGCTGCTACCAGTCGCTGCTGA
AGCTCACAGAAGCCGGCGGACCCATGGCGGTGGCTGCGTGCTCCGTCCTGCATTCGGTGTTTGCGACGCTCGAATGGTTT
GACCACAGTCCTGGCAGGGATGGTGCCTCAGATGCGATCCTTGTTCCCGTCCTGACGAAGGCGCTGGAGCAGCAACAGCA
AGAGCCGAAGGATAAGGCAGAGGACCACTCGACTGAGGTTCTAGGCCAGGCGCTCCAAGTGCTGGCCATGATGGGGACCA
CGCTGGATACGTCGTTGGAGAAGGGCAACCGTGACGAGGTGGCACTGCTCGGCGGTGCCAGGAAAGGGGCTCTCTTGGAC
GAGGGCGAAGAGCTTGCCGGTGGAGATGACGACAGCGAAGCCGGCGAAGGCAGCGATGCGGAGATGATGGAGGACGAGGA
GGAAGGCGTCCTTACGATTAACGGCAAGAAGAGAGGGAAAGAGCCCAAGACGGACGGATCCGATGCGGGTGGCGAATCGG
ACGAGGAGATGGACGATGCCGACTTGGACGCAGACATGGAAAATGTGACGGGTGCCGACGAGAAGGACGCAGAAGTCTCG
GAGCTGGGTGACCTCCCGACGCTGCGCGAACTGATCGGAACGGCGGTGCCGCAGATCATGCGGGTTGTGAAGGCACGGCC
ACAAGACGTGGATGAGGCAGCCTTGGCCATCCGACTGGACGCGTTGTCGGCTCTCAACAACATCGCGTGGACGGTGTCGT
GCATCGACCTCGCGGATGAGGGCAATGCGGGCATCCGACAGGCATGGGGCCGGGCAGCACGACAGATCTGGCTCGAGGTG
GTGCGGCCGCTGGTGACTGGTGCGATCACAGTAGACCTGCAGGTGGCGGCCAAGGTGACGGGCCTGGCCTGGGCGCTGGC
GCGGGTTCTGGGCGGCGAGACGCCAGCGGACGCCGGAGAGCAGGAGCGGTTCATGGCCATGCGGGATTCTCTGAGCGGCA
GCAGCGGAGAGAGCGGAGAGAGCGTGGATGGTAGCGACCCATTTCAGAGTCCTTCTGTGATGTGTATCGGGGTGCTTGGG
CAAATGGCACGTGACCCGGCGCCGGTGGCCACCAACCGCAAGATTGGCGAGTACTTCCTCGGGGTAGTAGAGGCGCTGCC
GGCGACACCGATAGCCGACGCGGTCGAGGCGCTGAACCAACTCTTTGACATCTACGGCGACGAGAAGGCCGAGTGCGACA
AGGCTGTGTTCTGGCCGGGCAAGTTTCTGGCGCGGCTGGAGGCGGACGTGGCCAAGATCAAGGCGGCAGCCAAGACGATC
GACAAGCGGACAGCATCAGAGCTGCGGACGCGCACCGACGAAGCCGTGCTCAACCTCGGGCGCTTTGTGCAGTACAAGAA
GAAGCATGCGTCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62