GenePrediction:GLEAN_3884 Details

Name: GLEAN_3884
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1474227..1477573 (+ strand)
Length: 3347
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1474227..1476242 (+ strand)
Length: 2016
Type: CDS
Source: GLEAN
Position: GCSC_113:1476342..1477184 (+ strand)
Length: 843
Type: CDS
Source: GLEAN
Position: GCSC_113:1477562..1477573 (+ strand)
Length: 12
>GLEAN_3884 class=GenePrediction position=GCSC_113:1474227..1477573 (+ strand)
ATGTTGAAGCGACAGTATTCGCCGACTCCGTCGGAGAACGAGGTGGACATTCTAGGGCCACTCTTTGCGGAGGAACTGGA
CGGGTTTGCCGGCTTTGACGTCGACGAGAACAGCAACGATGGGCGGCAACAGAAGAGGGTCAAGGCGATGGCCATGCAGC
CGGAGGACCTCGACCTGGGCGCGATCCTGGACGGGCGAGGTGGCGGTGCAGGAACGTACGGACAGGGCGACAGCGAGGAG
GATGACGAGGCATACATTGCGCTGCAGCAGGCTGCAGCATTCCGCAAGTCGAGCAACCTCAAGGGCAACACGGTGAAGAA
GGGCGGTGGATTCCAGGCTCTGGGGCTGAACGCGAACCTGCTGCGGGCAATCACACGCAAGGGTTTCTCGGTGCCGACGC
CGATCCAGCGGAAGACGATCCCGCTGATCATGGGACGCCGCGATGTGGTGGGCATGGCACGAACAGGTTCGGGCAAGACG
GCAGCGTTTGTGATCCCGATGATCGAGCGACTGCGAGCACACAGCGCGCGGGTGGGAGCGCGGGCACTGGTGCTGTCGCC
GTCGCGCGAGCTGGCGCTGCAGACGCTCAAGGTGGTCAAGGAGCTGGGCAAGGGAACGGACCTGAAGACGATCCTGCTGG
TGGGAGGTGACAGTCTGGAGGAGCAGTTTGGGCTGGTGGCGTCGAACCCGGACATTGTGATTGCAACGCCGGGCCGGTTT
CTGCATCTCAAGGTGGAAATGTCGCTGGACCTGTCGTCGGTGCGGTATGTTGTGTTTGACGAGGCGGACCGGCTGTTTGA
GATGGGGTTTGCGGCGCAGCTGACGGAGATCCTGCACGCGTTGCCACCGTCGCGGCAGACGCTGCTCTTCTCGGCAACGC
TGCCGTCGACGCTGGTGGAGTTTGCCCGGGCAGGGCTGCAGGACCCAAGTCTGGTGCGGCTGGATGCGGAGACGAAGATC
TCGCCGGACCTGCAGAGCGCCTTTTTCAGCGTCAAGGGCAGCGAGAAGGAGGGCGCGCTGCTGCACCTGCTGCACGACGT
GATCGGGATGCCGCTCGGACAGCCGGCCGGGCCAGCGGAGGCAGCGGAAGGCCAGTTTGCCGACGAGGGGTCGAAGAAGC
GCAAGCGAGACGCGAGCCGGGTGTCCTTCCGCGAGAAGCCGACGGAGCACTCGACGATTGTGTTTGCGGCGACGAAGCAC
CACGTGGAATACGTGGCGGCAGTGCTGCGCGAAGCCGGGTTTGCGGTGTCGTACGTGTACGGCTCGCTGGACCAGACGGC
GCGCAAGATGCACGTGGACGACTTCCGGCGCGGGCGGACGAACATCCTGGTGGTGACGGACCTGGCGGCACGCGGCATCG
ACATCCCGGTGCTGGCCAACGTGATCAACTACGACTTTCCACCGCAGGCCAAGGTGTTTGTGCACCGGGTGGGCCGGACG
GCGCGAGCAGGCCAGCGTGGCTGGAGCTACAGTCTGGTGCAGGACACGGACGCGCCGTATCTGGTGGACCTGCAGCTGTT
CCTGGGGCGGCGGCTAGTAGTCGGGCGCGAGGTGGCGGCCGGGGCGGCGGCACCCGATATGGGCCAGGACGTGGTGGTGG
GCTCGCTGGCGCGCAGCGCAGTAGAGCCGCACGTCGAATGGGTCAACACGCTGCTGTCAGACGTGACGGACGTGGAGGTG
CTGCGGACGGTGACAGTCAAGGCGCAACGGCAGTACTACCGAACGCGGCTGTCGGCGTCGAGCCAGAGCGCACGGCGAGC
TCGCGAGATGGTGGCCGGACCGGGATGGGGACAGCTGCACGTGCTGTTTGCGGCAGACGACGCAGACACAGCGGCGAGCG
GGACGACAGGCGAGACACGGGCCGAGATGCTGGCCAAGATCACCGGGTACAAGCCGGTGGAGTCGATCTTTGAGGTCAGC
ATGCAGGGCGGCAAGAAAGCGACGAAGAGCGAGGCGGCCGTGATCATGCGGACGATGCGAAAGAAGCTGGGGCCGCGGAA
GACGGCGGCGAAGGCGGTGAGCGTGGTGGAGGAGGGGATGGGTGACGAAGGGGTGAAGAGAGAGGGAGATAAGGAGGAGG
AGGAGGAGGAGGAGGACGATGACGATGACGAAGGGGAGGAAGGGGACGAAGGGGACGAAGAAGATGAGGTGGATGTGGCT
GACAAGACAGCGGGCATGGATCTGAGCAAGTTTGACTCGGACGCAGAGGAGGATGTCGGTGAGGTCGACATGGACTCAGA
CCTAGACAGCGACACGGAACAGGTGACGGTGGCAGACGACGCGACACACAGCGGCGGACCGACATGGCTGGACAAGTCGG
TGTACATGACATACACGCCGCGGACGGGCGGCAGCATCAGCCGGCGTGCAGCCGAGGAGCGAGGGTACGGGGTGCATGCG
ACGGGTGCGGACGAGGCCGGTTCGCTGAGCTTTGCGGCGGCAGCGCGGGATGCGACGATGGATCTGACCAACGACGAGAC
GGCCAAGGCGTTTGGGGTGCCGACGCGGTCGAAGATGCGGTGGGACAAGAAGCAGCACAAGTACGTGTCGCGGACAAACG
ACGAAGACGGGAGTCGAGCCATGGCGAGTGGTCGATCGGGAGCTGACGGTGCCGGCGGTGGCAAGCGGATGATCCGTGGC
GAGAGCGGCGTCAAGATTGCGGCATCGTTTCGCAGCGGCCGCTTCGACAAGTGGCGACGGGCCAACCGGCTGGGATCGCT
TCCACGCGTCGGTGAGAACGAGCGCGCCGGACTGTCGCGGCAGGTTGGCGTGGCCGACAGTTTTGGTGGTGGCGTCGGAC
TCGGCTCGCGCGGCGGTCACTTCTGGCACAAGAAGGAACTGGCACCCAAGGAGGCTGACCGGTTCCGCGACGATTTCCAC
GTGCGCAAGAAGCGCGTGGCCGAGGCGCGCGAAAACCGCGTCGGACGGTTTCGTGATGGCGACGGCAGCCGCGGTGAAGT
GCGCGGGGCAGAGGACATGTTGAAGAACCGGAAGCTGGAGGAGCAGCGACGGGAAAGGGGTGGTGGTGGAAGTGGAGGTG
GTAGTCGGGGACGAGGTGGAGGAAGTGGTCGCGGGCGGGGAGACAACCGGGGAGGAGGTGGAAGAGGTGGTGGGAGAGAT
GGAGGTGGAGGTGGAAGAGGTGGAAGAGGTGGTGGGAGAGATGGAGGTGGAGGTGGAAGAGGTGGTGGGAGAGGAGGAAG
AGGTGGAAGAGGTGGAAGAGGTGGAAGACATTAGTTTTACAGAGTATCAGTGGAGAGTACTTGGATACGATGATATTGTG
GAAAGTACAGTGTATGCAGTGTATGGAAGAGCTAACTGTACGATACAACATACAGGAGCAGATGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62