GenePrediction:GLEAN_3886 Details

Name: GLEAN_3886
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1494504..1496724 (+ strand)
Length: 2221
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1494504..1494735 (+ strand)
Length: 232
Type: CDS
Source: GLEAN
Position: GCSC_113:1495547..1495744 (+ strand)
Length: 198
Type: CDS
Source: GLEAN
Position: GCSC_113:1495811..1495818 (+ strand)
Length: 8
Type: CDS
Source: GLEAN
Position: GCSC_113:1495888..1496724 (+ strand)
Length: 837
>GLEAN_3886 class=GenePrediction position=GCSC_113:1494504..1496724 (+ strand)
ATGCAGGCATCTCACGACCGCAACCCCGCCAATGATGTCTGCGAGCTGCCGGGGCAAAAGGACGAGTGCGCGCCTGCGTC
GTGGCAAGGCGCGGCTGTGCTGCCGAGACGCGGGAGCGCGGTCAGGTCGTCGTCGCGAAAGCTAGCGGCTGCACGCGACG
CTGTGGGAATGATGCTCGCCACAGCGCCAGACACTGATGGCCTGGTTCGGGGGAAGTCGACGCTGAGCGATCGTGCGCAG
TGTCCCCGTAGCAACACGGTCCAGACGCGATGGGCTTCTCGGCGCGTGTCGGATGGCAGGAAGAAAGCGTGGTGCTGCGC
ACTTCCGATTTTTGGGGGGGGGATCGTTGTCATTATTTTACTAGCATTACGGCTCAGCACGAAGCAGTGAATTCGACGGC
AGAGAAGAGTGCATTAACGATCACCTAATCAAGATTAGCGTCGCACCCATCCCGCCTGTGCCACTCTGATTCTGGACCCC
GACACGGCCCATAATCGCTCTCGAATCACGACTGAGGTGGATTGGCCGGCCTGTTCTGCTAGATCTACAAGACAGCAGCT
TTAGTGCTCCGTACACTGGGCATAGTTCTTGGAGAGTGGGGCTACCCAAGCCGCAAAAGCGTGCCTTCCTCTCCAAGCTC
AAGCTTTAACGGCGCAGTAGTCCAGACCGTAAGATATCTTACCATAATCGTAATTCTCCTACCATCGTCCTCATCACATC
CCATCGCCATCCCGCCCATGGGCTCCTTTCTGTACAAGAGGGCCGTCTGGGCCGTGGGCTTACCTGCATGTCTTTGGTGC
TCATTTTTGGCTTTGGCTGTCAGCCCGTACTTCCAGAAACAGTTGGTCACAACCTCATGCCACCATGCCCTTGTTGCTTT
CGCTGCGTGCTCACCACTTTTTTTTCCAGATTTCTCTACGCACACAACATACTTCCCTGGTGGCAGGATACCAATCAGCC
ACAGCTATGGGGGTTTGCTAGTGCGTGACAGTCTTGCTGGTGCGGACTGGGCTTTCTGTGGCAGTCGCTGACCTTGGGCG
CAGAAAATCAAGTGACACCGTTCCATCTGACAACGGATGACGGTGAGCGCATTCATGCGTGGCATGTTCTGCCCCTTCCC
GTCTACCTGAAGCACGAGGAGACGCTGCGGCTGCAGCCGACTGGCTACTGTGACGATATCACTACTGCCGACTCCCTTCG
CATCCTTAGAGAGGACCCCAATGCGCAACTAGTCATCTTCTGTACGTCGTGGTTAGAAGGGTCACTGGGAGATATTTCTG
CTGGAACTGACTGCTGACAACCCTCAGTCCATGGTGTATGTGAGGTCTCGAGAGCATGTCCTCGCCCAGTTTACTGACAT
CTGTATTTGCTGCTCTCGCTCAAGAATGCCGGACATATTCCCGCCACGATTCGTGCGCCCTCCTTTCACTCGCTTACCGA
CACGAGCTCGTTCCACCTGCTTGCGATCGATTACCGCGGCTTTGGCCAGTCCTCGGGACAGCCGTCTGAAGAAGGCCTCA
TCCGGGATGCCTCCGCTGCCGTCGACTTTGTCCTCGAGACGGCCGGTGTGGCTCCTGACCGCGTCATCTTGCTTGGTCAC
AGCTTAGGTACTGCCGTAGCTGTTGCGGTTGCAGAGCGTTATGCGGTCCTCCGAGCTGTCGATTTTGCCGGCCTTGTTCT
TGTCTCCGGCTTCAGCAGCCTGCCCACCATGCTCTCCCACTACGCCGTTGCAGGGTGCGTGCCCATCTTGGGGCCACTCC
GCTCATGGCCGCGCGTGCTGCAGTGGATCTTGGGGTTCGTTGTGGAGCCCTGGTCGTCGGTAGAGAGGCTCGGAAGCCTG
GTGAACACTGTCCGCACAACCAAAGGACGGCACCTGCGTGTCGGCCTTATCCATGCTGCCGACGATTGGGACATTCCGAG
TGTCGAGGACGATAAGCTCTTCCTCGCAGCCGTGAAGCCCCTCCTGGGCAGCGGGACGAACGATTCGCAGTTGGCGGCCG
TCAAGGAAGCCCGCACCGTTCGCCTTGGCGGCGATGCGTTTGTGACGGAGTGGCGCGAGTCCGACGTGGTCATCCGTCAG
GAGCGGTTCCCCCATGGAGGTAAGCTCTTCTGGCTCTGTTGGAAGCAGGAGCGATGTGCTGACGGCCCAGGCCACAACAA
TGTCATGAAATACGCACCGGTAGTGATGGAAGTTATGCGGATCTTCAATGAAGAATACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62