GenePrediction:GLEAN_3888 Details

Name: GLEAN_3888
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1502313..1502794 (+ strand)
Length: 482
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1502313..1502624 (+ strand)
Length: 312
Type: CDS
Source: GLEAN
Position: GCSC_113:1502705..1502794 (+ strand)
Length: 90
>GLEAN_3888 class=GenePrediction position=GCSC_113:1502313..1502794 (+ strand)
ATGGCCATGTCTCTATCACAGATCCCGCGGCTGCTGTCGCAGTCCATGCTCTCGGCCACGGTGTCGCGTGTCCGCCCGAC
TGCGGCCGTCCCGGCGCTCTCCGCGGCCTTTGCTGCGCTCCGCGTTAACGTCCACCAGCAGCCACAGCAGCGGCGCGCCT
GCTCCGGCAACTGCAACGCCACAGGCCTGTCCCTGGTTGCCTCACGACCGTCCGTCTCGCTGGTGGCGGCCGCGGCACAG
AAGATCGTGCAGCAGCAGAGGCGCGGCATGAAGGTGCACAGCTCGGTCAAGCGGCGGTGCGAGCATTGCAAGGTGCGTCC
AGCGGATCGGAGAGGCCGGAGCAGCCGGCGTACAGGAATCACTCAACGGCAGCTAACCATTCGGTCTCACAGGTCGTCCG
GCGAAAAGGCGGCAAGCGGCACAAGGGCTACATGTACATCATCTGCCCGGCAAACCCGCGACACAAGCAGCGGCAGGGCT
GA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62