GenePrediction:GLEAN_3889 Details

Name: GLEAN_3889
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1509187..1512170 (+ strand)
Length: 2984
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1509187..1509385 (+ strand)
Length: 199
Type: CDS
Source: GLEAN
Position: GCSC_113:1509662..1509996 (+ strand)
Length: 335
Type: CDS
Source: GLEAN
Position: GCSC_113:1510052..1510091 (+ strand)
Length: 40
Type: CDS
Source: GLEAN
Position: GCSC_113:1510120..1512170 (+ strand)
Length: 2051
>GLEAN_3889 class=GenePrediction position=GCSC_113:1509187..1512170 (+ strand)
ATGGACGCTGCCGCACCCCCCCATCAAGACCCCTCGGGTCCCCCGTCCCTGCTGGCCTCTTCTGGCTCAGCTTCTGCTTC
TGCTTCTGCTTCTGCCTCGGCGACGGCCCAGCAGACGTCCTCCTCGCCTGGGCCTGCCTTCCGCACCGGCAAGCACAAGT
CCTGCGACGCCTGCAAGGCCCGCAAGGTCAAGTGTCCCAGTGCGTCTGACTCTGACCGTTGGGCCGAGCGATCGACGGCA
TTCAGCACGCACGCTGCCAGCTAACGCAACCAGACGTCAACTACCCGGCCCCTTGCGGCAACTGTGTTGTCAGTGTTGTC
TTGCGCACACACCCCCCTAAGCTCCATCTGCTGACAGGTCACAGCGTCGCAAGACAACATGCCATTTCGGCACAAAGAAG
GTTCCAAGACGCAACGGTAGCCTACCCTCTGGAACACCGCCCCCACGGCCCTAAAGAGATGCTAATAACGAACAGTATCC
GCCCATCTGCAGCTTGGCAGGCCATGTACGAGTGCCACTACCGGTGGGGTCCTCCACGATGCAACGCTTGACGGGGTGGT
CTCGGACGCTGTGCACACGCCGGAGGCTTCGCCGCTGCGCTATGTCAATGCTCTTCAGCCGGCGAAGCCGGGCGATGCGC
GCTCAGAGGCATCAGGAGCTCAGACGCCGACTGCCTCACAACCGGATGCTTACAGCCACGATGGCATCACCTGTGCAGAT
GCCGATACCATCCCGATGCTGTACATTGATCACATGCTCGCGCGGGCGCAGCACCAGACGCTCGGCAAGGAGTACACGCC
TCTGACAAAGGTGAGCAGACCACAGACAGTCCCTTTGGTCTATCGTTTCGCAGCTAACCGTCTAGGGGAACGGCATCTTT
GGCAAGTCCTTTCTCTACCACACGCGTCCGCAGTCCAGATCTAACTCTTCCAGGTGGCAGCTACAGTCTCACCTTCTTCT
CCGAGGGCCGTCTGCTCTCGCTCTCGTCGCGGCTGCAGAACAACAAGGTCAGCGAGCTGGTGCACCGCATCAATGGGGTC
ATCGTCAGCCGTCTGCGTCGCACCGAGCCGACGGCCCAGGAACCGCTGATGATGCCCATCACGCCCTTGGCCACGGACGG
CACGACCGACGTCGACAGCGCGGCCGCCCTGCCCATCGTCGACCCACCGTTTGCGGCCGCCTGCATCCGCAGCTACTTTG
ACAACGTGCACAGTCACTACCCCTTTCTCGATCAGGCCTCGTTTGAGCGTCGCGCCGCCGATGCCGACCTGGCCCGCAGC
CTCGCCAACAGCCGGGCCTGGTCCTCGCTCTACCACGCCGTCTTGGCCATCGGTTGCCACTATACCGACGGCGGTGGTGG
CAACGGCAGCTTTGAGCCCGGCAAGGGCACGGCCTGGCGGCTCTTCAGCGTCGCCCTCGGTCACTTCTCCGAGCTGCTCA
TCCTGCCCGACTCGCTCATCACCCTGCAGGCCCTGACGGCCATGGCTATCTACGGGCTCGACGTGGCCTGTCTCTCGATC
GAGCGCGTCCTGCTGTCCGAGGCCGCTCGTCGGGCTCAGAGTCTCGCGGCCGCCAGCAGCAGCAGCAGCGGCGGCGGCGG
CGGTGTCGGTGCCAACAGCGGCAGTGCCGGCGGGCTCATCAACCCGGCTTCGTCTGCCACCTTCCAGCGCACATTTTGGG
TCCTGTACGGCATCGAGAAGGTCATGAGCTTCCACTTTGGCCGCAGCTCGTCGTTTGTCGACAGCGACATCTCGTGTCCG
CTACCAACCATCCCGGCCGTCCGGCTGGACGAAGAAGACGATGGCGACGGACCCGACAACGAGACACACCAGCCGACACC
GCCGCAGCAGACGGCCCCGCATCGGAAGCCGCAGTACCTCGACTGGTTCCTCATCTGGATCCGCCATGCCCGTCTGCTCT
CGCGCACGTACACGTCGCTCTTCTCGGTCGGCACGTCGTGCAACTCGGCGGCCAGCAGCCTGGCCACCATCGACCAGCTG
GCTGCCGAGGTCGAGGAATGGCGCCAGTCGATCCCGGACGTCCGCTCGCTGCGACCACAACCCGGACCTGGCACCAGCCA
TACGGCCCACCATCGGCGCCAGCGTCACCGGGCCACAGCCACCAGCAGCCGCGGCTCGCGCGACTTTGAGCAGGGCACCA
CGCTCGCCCTCAGCTTTCTGTACCACAGCTATGCCCTCATCCTGGCGCGTGCCCGTCTGCACCACCAGGCCCGGCTGACC
GGTCCCCAGGCCATGGCACCGGCCCAGCTGCTGCAGCAGCAGGCGGCCAGCGAGCAGGTCATCACGACGTCGTGCCGCGC
CATCCTGGAGCAGACGCCCTTTATCGAGATCGAGCCGTACACGCCGCTCTGGATCCTGGCCGTCGCCCCGCTGTCGTCGC
TGCTGGTGCTCTTCGACTTTGTCATCCACCATCCGGCCGGGCCCGACGCCGCCTCCCATCTGGTCCTGCTCGACATGGGC
TCCGGCTACTTTAGCCGCATCGAGTACACCAGCGGCGGCACTTTGCCCGGCTCGCTCGTGTCCGAGTTTGTCCACATCGC
GCGCGATTATGTCAACGGCCGTCAGCACTACGGCAGCGGCCACGGCGACGGCCCCGGCTCCTCGCAGCAGCCCCTGCCCA
TACTACAGCCGCCGCTGCCGTCTCTGGTCAGCCCGACGATGCCCGACGCTGCCGAGACGGCCCAAGCTCAGTCGATGGGC
CTCGTCGACACGTCGGCTCTCGCGGCTGTCGACTGGTCAGCCGTCACCGCTGCTGCCTCGTCTGTCCCTCCGTCTAGCGC
CGGCACGCTCGTCGCGCCAGGTGGCGTGTCTGGCTACAGCGACAGCTTCGGCTACGGCTACATGGGCTCCGGCAACGGCG
CTGGCGACTTCTCAGGCACCGACGTCATGGGCCTCTTCAGCTACCTCTTGCCCGAGATGGACTCGATGCTCTATCAGGGG
ATGGCTGACCAGGGATTTGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62