GenePrediction:GLEAN_388 Details

Name: GLEAN_388
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1474329..1475818 (+ strand)
Length: 1490
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1474329..1474946 (+ strand)
Length: 618
Type: CDS
Source: GLEAN
Position: GCSC_167:1475009..1475818 (+ strand)
Length: 810
>GLEAN_388 class=GenePrediction position=GCSC_167:1474329..1475818 (+ strand)
ATGTGGTGGATTTTCCGGCTGCTCTTCAGCACCTGGTTTTTATTAAGCGTCGTGCTTTCTATACCCATCGCATTTGATGT
CGGAGGCCGCGATGCCGGCCTGGCCTACAGCCTGGCCCTCTTTCTATACTACTTCGTCTACTCGTCTATAAAGATCGTGT
TCAAGATAGCGACACCCCCGGAGGCGCGTCCCCTACGCCTAGCCGTCTCGGGCGTACTTCGGATGTCGCAATGGTTTGTC
CTGCCAGGCCTGCTTATCTGGTCATTGAGTCGCTTCTCTGTCGATGCGGGAGGAACCGACTGGGTCGCAAAAACGGTTGC
CCATGTTACCGGCTCGAATGGCGCTGCCACTGGCACAGGGCCGGACGGCCACAGCTTTGTGGGCTATGGCGAAGGCGCTC
TCTTTAGCAGTAGGCCCGCGGGCACCAGCTTCTACGACTGGGTGCTCGGCCACGGCGGAGTGGTGGAGTCTGTTGCTCTC
GGCCTCTGGGAAAAGTCACTGCGCTACTCTAGCCCCGTATTTCAACTGCTCGAAGGCTTCTGCAGTCTACTGGTCATCCA
GGCGGCAGGTCAGATCACACGGTGGCTTGTCAATCGTGGAAGGAGTGACACCTACGTGGTAAGACAGCTTCCCCCTTACC
TCGCTATATGCGCACATGCAAGCTGACACACTGCTTGCAGATAATACTTCTTGCTTTTTCGGGGTCGATCATTGCTAGCG
CAGCACACTTCCTCTGGCGGGTAGTACGGTTCCCCCAGATCGACAACATCGATGCTACGTTGATCGGGGTGACCATCACA
TCTGCCGTCTTCCTCTCTGCATACGGCATCGGCAGCGGTCGCGGAAATCCCGTGGAGTCATCCCTGCTCTTTGCCTACAT
TGTCTTGTGCGTGTATCAGATCTTTACCGACTATCTGCCGTCATCGCCAGAGGCTGCAGCCCGTGCGGCAGCAGCGGCGC
AGCAGCTGCCCACGCAGCCCGAGTTCCCACCCTTTCCCCCGATCATCATGGCCTCATATTCGACCCTAGTGTATCTGCTG
AGCACACTGCCGAATGCGGTCAACTCCGCCCTCACCTTTTTCTATGCCGCCTTTCAGACGATTACACCGTCTGTCTTGGT
GTCACTCACCTACCGCATCATCGTCTTTTACTGTGCCACTCGCATTATCCCGTCTGTACAGGAGTCGGGTGCGCGAGCAC
TCTCAAAGGAGCCAACACTGGAAGACTCAGATGCTGCAAGCAAGCTTCTTGGCTTCTTATCGTGGTTCTCGGCGTCCATA
CTCATCGCAGTATACACAAGCTTGCTGCTACAACACTTCCCCGTGTCTAATATGGGGCAAGAAGCCGGCTGGACACTCAG
TGGTGGCAATGCTGGGGGCACAAGCTGGCGGTGGATCAACGCCGTGGGCGTCATGGTTCTCTACGCCTTTGAAATGTACC
TGGGCGGCGATGATGAAAGCAGCCTGACGAATCACTGGAAGATGGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62