GenePrediction:GLEAN_3890 Details

Name: GLEAN_3890
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1512449..1513311 (+ strand)
Length: 863
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1512449..1512546 (+ strand)
Length: 98
Type: CDS
Source: GLEAN
Position: GCSC_113:1512608..1513021 (+ strand)
Length: 414
Type: CDS
Source: GLEAN
Position: GCSC_113:1513086..1513311 (+ strand)
Length: 226
>GLEAN_3890 class=GenePrediction position=GCSC_113:1512449..1513311 (+ strand)
ATGGCGGTTAAGAAACGCCGGCGGGCAGCGACGAGCCCAATCGAGCGGGCCAACCAGAAGAACGACGAGGATTTCATCGC
CTCGTATCTGGCGCCAGGGTAATGCTTGCTCGCTCTGAGCGACGAGACGAAGGGTAAAGGCTAACGGCCGGCGATGCAGG
GCCCCTCTGGCAGTGCCGTGGACCGCCCGCTGGACGCATCCACAGACAGGTGCGGCCTACGATGTCAGCCTAGCCCGGTC
GGGCTGCGTGGGTGAGGCCGCGCTGGAGACGTGCTTCGCCCTGATCGAGGAGACGAGCCGGAAAGACTACGACGGCTCGC
AGCAGAAGTGGCAGCCGGCCGACAAGCGACGCGAGATGCGAGAGGCGGACCTGCGGTATATTCTTGTGCAAGAGGTAAGG
GGAGAAGAGGCAGAAGAAAAAGAAGGAGAAACAAAAGAAAGAAAAGGAGGACAAAAAGAAAAAGACCAATCACATCAACG
CATCCGCGGCTTCACATCCCTGATGCCTGCCTACGAAGAGGGCCAGCCAGTGGTCTACTGCTACGAGATTCACCTCAAGC
CAGAGCTGCAAGGGTACGTCTGCCCGTCTCTCGTCTTCCATCTTCCCTCTTGCCTCTTGTGCTAACTGCCCCCGAAGAAC
AGGCCTGGCCGGCCTCCTGCTGGGCTTCCTCTACACCATCGCCTACAACCTGCCGCTCATCGCAAAGGTCATGCTGACCT
GCTTCCTGTCCAACGAGCGCGCCCTGCGCTTCTACCGCAAACAACACTTTGTCGTCGACCCCATCGCTCCCGAGATCCGC
CAGCTACGAGGCAAGACTGTCGTGCCCGACTACACCATTATGAGCAAGGCCGTCAGGAGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62