GenePrediction:GLEAN_3891 Details

Name: GLEAN_3891
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1514060..1514778 (+ strand)
Length: 719
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1514060..1514342 (+ strand)
Length: 283
Type: CDS
Source: GLEAN
Position: GCSC_113:1514398..1514512 (+ strand)
Length: 115
Type: CDS
Source: GLEAN
Position: GCSC_113:1514577..1514778 (+ strand)
Length: 202
>GLEAN_3891 class=GenePrediction position=GCSC_113:1514060..1514778 (+ strand)
ATGGAATCAAAAGGACAGATGCCGCCGTATGCCACCACGCCGATGGCCCAGCCCGCCCAGTACCAGTACGAGCACGATCC
CCATCCGAGCCAGCAGACGGCCTACCAGCCAGAGGTGCAGGCTGCTCCCCAGCAGTACCAGCAGACCCAGCAGCCCGAGC
AATATCGCGCGGTCCAGCCGATGCAGATGGCCACGGCTGCCGTCCCTGGCGGGTGGCAGTCCGACCTGCTCGACTGCACG
CCGCTCAGCACCTGCTGTCTGGGCACCTGGCTGCCCTGTCTCCGTGCGTGTTCCGAAAGCTGGACGAGGGACGAGAAAGC
CTCACTGACATCACCCAGTTCTCGGCCAGACGGCCGAGCGCATGCGCAATCCCGCCAACCAGAATCCCGACGGCTGCAAC
GCCGACTGCATGGTCTTATGTGCCATCCAGTACTGTACCGGCTGTGGCTGGATGTACGTCCTCGTCTCTCTGCAGCCTTC
TGGCTGGCCGGCTAACCTGGGTCTCCCCTCGTCACAGCTATGTCATGGTCAAGCGCTCCGAAATCCGCCAGCAGCTCGGC
ATCAAGGGCAACGGCGCCTCCGACTGCTGCACCTCCTACTGGTGCACATGCTGCGCCGTCATCCAGCAGGAAAAGGAGGT
CGTCGCGCGCACGGGCGGCGCCGCCCCCATCACTCAGGGCTACCAGGCCCAGTCCAGCATGCAGATGCCGCAAAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62