GenePrediction:GLEAN_3892 Details

Name: GLEAN_3892
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1516920..1519116 (+ strand)
Length: 2197
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1516920..1516988 (+ strand)
Length: 69
Type: CDS
Source: GLEAN
Position: GCSC_113:1517059..1517712 (+ strand)
Length: 654
Type: CDS
Source: GLEAN
Position: GCSC_113:1517782..1519116 (+ strand)
Length: 1335
>GLEAN_3892 class=GenePrediction position=GCSC_113:1516920..1519116 (+ strand)
ATGGCCTATCCAGACGATGCGATCAAGCGTGAAGAGGATGAGGATGCAGACGAGGAGATCGACGAAACTGTACGTCATTC
GAGCCTTCTTCTGTTCACATGAGAGATCGCTGATGGCCCATACTCGCTGGCTATTGCAGAACTACAAAACGCAAAAAGAT
GCCGTTCTGTTTGCAATTGACGTGAGCAGCTCCATGCTGGAGAAGCCGCCACCGCCGGCCACCAAGTCCAAGTCGGCCGA
CCGGGACAGTGCCGTCTCAGCAGCGTTGCGGTGTGCCTACCAGATCATGCAGCAGCGCATCATCGCCCAGCCCAAGGATC
TCATGGGAATGCTCTTTTTCGGCACAGAAAAGTCTAGGTTTCGTCCCGGCGACGGCGACGGTGGCGAAGATGCAGACAGC
TTGGCATCCATCAACCACACGTCCAGCTACCCACACTGCTACCTGTTCATGGATCTCGAAGTGCCTGCTGTCGAGGACGT
CCGCGCGCTGAAGAGCATGGTGGAGGAGGGCGAGGACCCGGACGAGGTGCTGAAGCCAGCGCCAGCCGGCAAGTCTGTGA
CCATGGCCAACGTGCTCTTCTGCGCCAACCAGATCTTCACCACCAACGCGCCCAACTTTGGGTCGCGCCGCTTGTTCATC
ATCACCGACAACGATGACCCGCACTCGGGAGACAAAGCTGCCCGCTCGGCGTCGGCAGTGCGCGCCAAGGATCTGTACGA
TCTGGGCGTGGGAATCGAGCTGTTTCCCATCAGCCGCGAGGGCGCCAAATTCGATCTCGGCAAGTTCTACGACGTACGAT
CGCTGACTCACCGGCCCTATCTCTGGGAACATGGCAGCCAGTACTGACTTGAGACCCTGCAGGACATTATTTACCGTGAT
CCCGCGGCCGAAGACGGATCCTCTGGCAGGGTCATTGCTGCTAGGTCTGGCGGCGGCCTGTCGCTTCTAGGGTCTCTGAT
ATCGAATATCAACGCCAAGCAGACGCCCAAGAGGTCGTATTTCTCGAACTTGACATTTGAGATTGCACCGGGGCTCAATA
TCTCTGTAAAGGGATACATACTGCTGAATCGGCAAAAGCCAGCACGGACATGTTACGTCTGGGTAGGTGGCGAAATTGCC
AAGCTCGCAACGAGCGAGACGATCAAAGTCGATTCCGACAGCACGCGAACGGTCGAGGTTGGGGAGATCAAGAAAGCATA
CAAGTTTGGCGGCGAATTCGTTTACTTCACACCCGAGGAGCTTAAAGGGTTCAAGACGTGGGAATTTCCCGATGGATGGA
ATGGAAAAGGCCTACGCATTATCGGCTTCAAGCCGCGCGTCCTGATTCCATCCTGGGCGTCGGTGAAGCGGTCGACGTTC
ATCTATCCCAGCGAAGAGGACTACGTCGGCTCCACGCGTATCTTCTCGGCCCTGTGGCAGAAGCTGAAGAAGTCTGAAAA
GGTGGCTATTGCGTGGTTTGTGCCGCGGATCAACACCAACCCGGTTTTGGTCGCAGTCATTCCCTCGAACGGTCCAGACG
GAGGTAGTGAGGGCGATGGCGATGGCAGCGGCGATGGCGAGAAGAGATCGGTGAATCCCTCACACTTGCCGGCTGGCCTC
TGGCTGTACCCTTTGCCCTTTGCAGAGGATATTCGCAAGTTCGACGACAGCCGCGCGCCGCTTCCACGGCCTGCAGAGCT
GACCGAGCTTATGAAGCCGGTTGTGGAAAACCTGCTTCTGCCGAAGACGGCCTACGATCCGGCCAAATATCCCAACCCGG
CACTGCAGTGGCACTACAAGATCCTGCAGGTGCTGGCCTTGGACGAAGAAGTGCCGAAGCAGGGCGACGATCCCACGCTG
CCCAAGTACAAGGCCATCGACAAGCGGGTAGGCGGCAGTCTGGCGGAGATCAAAGAACGGTTGAAGAGCGAGGCAACACA
CCTGCAGACGGTAAGGGCAATAAAACGCGAGGCCGAAGACGACGGAGCTGGTACGATGGGGAAGCCACTGTCGAAGCGGC
CAAAAACGACATCAGCGGCAGCCGAGAAGGGAAAGATGTCGAACAAAGACATCCAGAATGCCATTGCGACGGGCAAGCTG
TCGGCGAAGCCGGTCGTAGAGCTGAAGGAGATCTTGAGCAGCTGGAGTGTCAGCACATCTGGGAGAAAAGCCGAGCTTAT
CGAGCGGATTGAGCAATGGGCGGACGGAAATCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62