GenePrediction:GLEAN_3893 Details

Name: GLEAN_3893
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1519643..1523169 (+ strand)
Length: 3527
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1519643..1520174 (+ strand)
Length: 532
Type: CDS
Source: GLEAN
Position: GCSC_113:1520252..1522505 (+ strand)
Length: 2254
Type: CDS
Source: GLEAN
Position: GCSC_113:1523100..1523169 (+ strand)
Length: 70
>GLEAN_3893 class=GenePrediction position=GCSC_113:1519643..1523169 (+ strand)
ATGGAGTCGCTTCTCGGGGCGGCAAGCAATGACGTGACGCAATGCCGATCGGCGGACGATATGAAGGCGTGGATGGTGCG
GCTGTTTGCGGGCAAGCTGTCGCCGACGCGTGCGGAACACGTGTCAGCGTCGTTTGACATCCCGTCGGACGTGGTGCTGG
ATCTGGGCGCAGCAACGCATAGCGGCAGTGAGTCGACGGAGACGGCAGCCGGCGGCGACGCGACGAGCAGTTTTGTAGGT
GGCACGGGCCTGAATGCGGCAGTGAAGAGCTTGGTGCAGGTGCGGGACGTGGTGATGAACCAGCCGACGGACCGGCCGAT
CCTGCAGCAGGCGGTCGCGACCTTTATCGTGATGAGCATGCGGGAGACAGACGGCAGCGTGTGGGAGGCGCGATCGGCCT
CACGGTCAGGACACGGCTGGACGCTGACGTGTGCCTGCAAGGGCTCGATGGAGTGCTGGTTGCGGGCGCATCCGCGCCGC
AGCACTGTGGGGCAGTCGAGCAGCGACGACATGCGGGACCTCGTCAATTTGTGTGAGTCTGAGCTTGGCTCCCGGTTTGC
TGTCGTTTGCCTGGGCGGACACGCTGACGTTCTCTCTTGTTGTCGGCAGCCCGTCCTGCGTTTGACTGCCGCGGCATCAT
CACCATCACGTTTTCGCGCTTCAGCCGATCGATTGTAGTCAAGTACGAGCACACCAACTTCCACACAACCGTGGCCCAGC
TATCGAGCCTCTTTCCCCCACCACGACCACCGTCTGCGGTTGGGCAGGCGAACGGGGTGCCTGGATCGGCAAAGAAGCGG
CCAAAGCCGGCTGGCGAGCCGGGCACAGAGGGCACGCCCAGGACGAAGAAGGCGAGGCAGACCGTATCGACCGGGCCAGA
GCAGGCCGTGCCAGAACAGGTTGCATCGGAGCAGGCGGCAACAGCACCATTAGTACCATCAGCACCATCAGCAGAAGCAC
CACCGACAGAGTTTGCAAGCGCGCCACGGGATTGGGTGGTGCTCACAGGCTCAAAGGCAAAGAAGCCGAGGAAGCCGCGA
AAGCGGAAGCCCAAAACGGGTGCAGCCGCAGATGTTGCAACTGCAGCGACTGTAGAGATGGCCAGCGTGGCTGTCGTGGC
ATCCGAGGCCGTAGACGTGACGACGACGACGACGACGACGACTCAGGACGCTGATAGGAGCCACGCTGTCGAGATATCCG
ATGGCGACGTGGCACATGCTCTGCAGCAGTACCTGGACACGACCCCAACAGACGGCCCAGACGACACGGCTTCTGGGCAG
GTCCTGGATGGTAGCGATGCTGCTTCTGCTGCTGCTGCTGCTTCGTCCGCTAGCGTCTCTCAGTTCGAGGGCGCAGTCAG
CAGGCCGAGCGAGGTCTCCCCTTCGCAGCCAGCAGCATCCACAGCTGCTGCGCCCACAGGAACGCTGACGAGTGGCAGCG
AGGAGCCTCTAGCCGCCGAGAAGCCACCACAGCCACAGCAGCCACAGCAGCCACAGCAGCCACAGCAGCCACCGTACATG
CTGGTCACAGAGGCGCAGGTGTCGTCGCAGCGACAGTCTACGGCCATCAGACTGCTGACGGAGCGCAACGTCGACCCGGC
GACGCTGAACCACGAGCAGTTCTGCACATTTGCCAACCAGGCGCCGAGCCTGCAGAAGGAGTCGCTGGAGCTGCTGGCAC
ACTACGGCGCCGAGAGGTTGGCGATCGTGCCGCCGCGCAGCCGCTCTGCCGCAACGACACAGCCGGCGACGACACCACAG
CCTGTGGCAGCGCCTGCGGGAATACCTGCGGTTACTGCTGGTCAGGAGGCCCCAGCAGAGGTACAGGAGGTGCCGATGCC
GTCGCAGACACAGACGCGAGCACAATCACAGGAACTGGGAGGTGGTGGCCAGACGGCTTATCCTACCCCAGCAACGACTG
CAGCCGATCCGGCCAGCCACCAGGAACAGGTCAGCACGGCCATGGAGCGGCCATACGTCAGACAAAGTCAGCCGACAGAA
GCGACTGCACCTGCACAGACAAGCAACGAGCAGGCTACCCCACGGAAACCTGCCCGGCGCAGATCACGCAAAGCGGTCGA
GCAGGTCGGGCTTCTAAACGCGGACGACACGCTGTCGGGCTCGCAGTCGCAGACCGCTGCCAACGGTTCGGCAAAACCTC
CGAGGAAACCGCGTGCCCGCAAGTCTGCCGCTGCTGTGGCGACAACAGACACGACCATGGCATTGGCAGCATCTGCTGAC
CAGGGCAAGCCCAACATCAACGGCCAGCAGCAGCAGCAGCAGCAGCAGCAGAACAGCCATCCTCCGACGGTCTCTGCCGC
TTCCTACTATACACTCGAGCAGCTGGCTAGCCAGACAGCATCGACCAGCAGCGTCTCCGACACGGCCGCTGCTGCCAGCA
CGGGCTCCGGGAGCGATGGCAGCGGCCACGTGCAGTACAGCAGCAGCTACTCGCAGTACAGCAGCTATGGCGGAGCAGCA
GACGTCGCAGGCAGCCAGACCAGCCAGCCGGCTTACAACAGCTACGGGAACGAACCGGACAGTCGGACGGCCTACCGGAC
TATGAGCCCCAGCTATGCCCGATACGGGACCCAAGCAGGAAACCAGAACCAGAGCCAGACGTCCATCGGCGATGTCGCTG
CACCGACCACAACTACGGCTGCCAGTCTTGCCACCAGCAGCAGCAGCAGCAGCAGCAGTACTGGCAGCAGCGCCTTTTCC
AGCCGCGCATACGCCCAGCCTCACGCGTACAATGCCGTCGCGGCACCCGTTCCTGCAGCAGCCCGCAATGTGGGTGGCAC
CGATGGGGCGAGCGATCCGTGGACGACGGCTGGGACGGCGACAAACACCGTCGTCGGGCAGACGTATGCTTCTGGGCGAC
ATGCCATTCCAACCGAGCGGCCGGCATACCAGAGACCACAGCCACAATCGCAGTCGCAGCCACAAGCACAGCCACAAGCA
CAGCCACAGACACAAGCGAGACCCCAACAAGACTCGTCCAGCACGACCTATGCGCAGGCGATACAGTTGCGTCAGCAGCA
ACATCAGCAACAGCAACAGCAACAGCAACAGCAGCGACAACAGTGGCAGCAGCAGCAGTGGCAGCAGCAGCAGCAGTGGC
AGCAGAAACAGGCAGCGCCAGAATATCCCAAGCAGGCAGCAGCAGCTCAGCCACAGCCTCAGCGGCAGCCAGACCAGGTG
AGATGGCCGTCGCAGCCACAACAGACACAGCAGCCGTCGGACCATCTGAGCTGGCACAAGTACGGGGGCGACAGCACGCG
CCACGGCAGCACGGGCAGCGCCGGCCTGTCTAGGGTAGCTGTTGTCCAGCAACGACAGCCGCAGCCGCAAGCGCAGTCGC
AGTCGCAGCCGCAGGCTCACTCTCACTCCCCGTTCCAGTCTCGGCCCCAGCCCCAGAACCAGGCCTACAGTCGGAGATCC
GGGGGCTTTGGAGACAGGCGGACAGGCTACGGCGCTGCCAACGACGAGGAGTACTATGAAATTCTACGGCGGACGCAGGG
ATCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62