GenePrediction:GLEAN_3894 Details

Name: GLEAN_3894
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1526629..1527752 (+ strand)
Length: 1124
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1526629..1526939 (+ strand)
Length: 311
Type: CDS
Source: GLEAN
Position: GCSC_113:1527005..1527101 (+ strand)
Length: 97
Type: CDS
Source: GLEAN
Position: GCSC_113:1527152..1527187 (+ strand)
Length: 36
Type: CDS
Source: GLEAN
Position: GCSC_113:1527348..1527752 (+ strand)
Length: 405
>GLEAN_3894 class=GenePrediction position=GCSC_113:1526629..1527752 (+ strand)
ATGACGCTCCGGCAGCGTCTGACCAGCGAGACACGACCCTACCAGCCGACCGCCAGCAACGCGCCACGGCCGACGCGCAC
GAGCACGATGCAGCCGGACGGACCGGCCGAGATGCTGCCGCTGATGGTCGATGACGACGACGAAGAGCTCTCGGACTCTG
AGCTGGCAGGTGTGCGTCGGCCGCTGCAGCCGCCGCTGCCATCGCAGTCACCGCTGCCGGCCAGCCGCTCGTGGCGGCAG
CAGAACCAATGGATCGTCCTGGCGCTCGCCAGTGGTGCCTGTGCTGCTTTTAACGGCGTGTTTGCGAAGCTGTGAGAATC
CCCTTGCCATCGGCTGCGCTGCTGTGGAACGCGCTGACCGGCCCGCCCTCGCGCAGCACCACGACCAAGCTGACCGGCCA
TCTGGCCCTCGGCCTGGCACACGCCCTCGGCCTGACCAAGGCTGCCGCTGCTGTCGAGATTGTCGTTCGGGCCGTAAGCA
TCTGCTGCTTCCTGCGGCAAAATACCGTGCTGACCTTGACTAGGTCTTCTTCGGTCTGAATCTGGCGTTCAACGGCTTGG
TGCGTCCTGCTCTGCACATGTTTCCCTCTCCACTTGTCTGCTGGGTCGCCAGCGTGGCGACAGGCTGAGTCCTGATTGGA
CCACAGACCGGCAGCTCTGTCCCCACGTACAGAGTACGATACTTTCTCGTACTCGGGCCCCCCGCTAACCACCGGACAGA
TGTGGACCGTGTTCACCAAAGCGCTCGCCCGCGGTCACTCGGCAACCCAGGTCTCCGTCATGAACACGTCGGCCAACTTT
GTGCTGACCGCACTGCTGGGGCTGATGATCTTTTCCGAGGCGCTGCCTCCACTCTGGTGGCTCGGCGCCGCCATGCTCGT
GGCCGGCAACGTCATTATTGGGCGCAAGGACGAAGCCGGCAGCGACCCGGCATCGCACACCGACGAAGAAGAGCTGACTG
TGGAGCCGCACACCGCTGTTGCGTTTTCGGATGACCTTACCGCTGCCACGAGTTCTGGGTCCAACAACACACCGAGGCAC
CGTGCCTCAGCCTCCATCCACGGCTCCAGTGTCCCCAGGGAGCACGACGAGGATGTGCTGGATCTAGACGTAAGTCACAT
TTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62