GenePrediction:GLEAN_3895 Details

Name: GLEAN_3895
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1539704..1541311 (+ strand)
Length: 1608
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1539704..1539785 (+ strand)
Length: 82
Type: CDS
Source: GLEAN
Position: GCSC_113:1539842..1539891 (+ strand)
Length: 50
Type: CDS
Source: GLEAN
Position: GCSC_113:1539954..1539998 (+ strand)
Length: 45
Type: CDS
Source: GLEAN
Position: GCSC_113:1540066..1540213 (+ strand)
Length: 148
Type: CDS
Source: GLEAN
Position: GCSC_113:1540278..1540358 (+ strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_113:1540431..1540507 (+ strand)
Length: 77
Type: CDS
Source: GLEAN
Position: GCSC_113:1540568..1540879 (+ strand)
Length: 312
Type: CDS
Source: GLEAN
Position: GCSC_113:1540934..1541311 (+ strand)
Length: 378
>GLEAN_3895 class=GenePrediction position=GCSC_113:1539704..1541311 (+ strand)
ATGACAGTCAAGATAACGCCCAAAACCCGCCTCATTGCGACGATTGTTATCTCCTTTTCCTTCTTTGTGGCCGAGATAGC
AGGTATGCTCTTTCTTGGTCACCCCAACAGTTTGGTCTGCGTACTGACGTGGTCGTAGTTGGCTTCAAGACGAGGTCGCT
AGCCCTGATTGCCGATGCGTTCCACTATGTAAGCTTGACTGAGAAACAAGCTTCTGTTGCACGCAAAATACTAACCGCAG
CCGCTATCAGATGAACGATCTGGTCGGCTTCATAGTCGCTTTAGCTGCGCTTATTGTAGGTCCTGGCTCTGGGAGATGCA
GTATGCATCCAGGCATTCAACACACAGCTAACACGACCATAGATCTCGGAGCGCTCCAGCTCTCCCCAGGACCTTTCGTT
TGGATGGCAGCGCGCACGGCTTCTTGGGGCCTTCTTCAATGGCGTGTTTCTCCTTGCTCTAGGCATCAGCATTTTCCTCC
AGTCTATTGAGCGATTTGTGGCTCTACAACGTCGGTCTCTCCCTGTTCCCTTCACACTGGCACTACCTTTCTACTTGTGC
TAACTCGGTTACAGACGTAAATAACCCCAAACTCGTCCTTATCATGGGATGCGTCGGCCTCTCCCTCAATATAATCAGTG
CAGCTTTCCTCCATGGTAAGAGTTTTGTATTCAGCAAATCTCTGGCTTGCCATTGCTGGACGATATCAACTAATTTTGGG
TATTCAGAACACAGCCATGACCACGGCCACGAGCATGCACACGGCACGGAAGCTGACACCGAGCTTACACAATTCGAGCC
CGCCGTAAGTTCTTCAAATTTGTTATTTATTGCATCTTGCTGTATGCTAACGCTCGGTACTCAGGCCCCACAACATACAG
AACACCGGCACCTGAACATGACGAACGAGGGCCCCGACCGTGATCTCAACATGCTTGGCGCCTTTGTGCATGTGTTGGGG
GATGCTATCAACAATGTTGGCGTCATCATATCTGCCGTGGTGATTTGGAAGGCATCATACCCCGCTCGTTTCTACGCCGA
CCCGGGCGTCAGCATGGGCATCGCCCTGATGATCCTCATATCAGCCATGCCATTGGTGAAGCATAGCGGTACAATTCTGC
TGCAGAGCGCGCCACCCGGGGTTGATATCGACGATGTCAAGCATGACCTTGAAAAGGTACGCTTGGCGTTTGTCACAATG
CTTTCCACCGCTGACATTCTACTCGTACAGATCCCCGGCATCGAGTCCGTCCACGAGCTTCACATCTGGCGTCTGGACCA
GCAAAAGGCCATTGCCTCAGCCCACGTGGTCGTTTCGGACCAATCTATATCGAGCTTCATGGACAAGGCCCACACCGTGA
CCGAGTGCCTGCATGCATATGGTGTTCACTCCGTCACCCTGCAACCCGAGCTGTCTATTTCATCCCAGACGTCTGCCGCG
AGGGCAGCGAGCGAAGACTCGAGCACCCCTATCACAGGAGACAACTCTGCCGGGATTTTGCAGTCTTTCCCCGTGTCGGC
GATCCGTAGGAGGAGACTCGACCATGGAAACTGCCAAATCCCCTGCGGTGCTCTGTGCAAGAACCTGGCGTGCTGCACGC
CTCCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62