GenePrediction:GLEAN_3898 Details

Name: GLEAN_3898
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1557251..1557865 (+ strand)
Length: 615
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1557251..1557351 (+ strand)
Length: 101
Type: CDS
Source: GLEAN
Position: GCSC_113:1557422..1557577 (+ strand)
Length: 156
Type: CDS
Source: GLEAN
Position: GCSC_113:1557643..1557709 (+ strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_113:1557773..1557865 (+ strand)
Length: 93
>GLEAN_3898 class=GenePrediction position=GCSC_113:1557251..1557865 (+ strand)
ATGTCGGGAGAAGCGTGGCTCTACCTCTTCGCCGTGTTGATCAACGCGGTGAACCTGTTCCTGCAGGTGTTCTTCACCAT
CATGTACAGCGACTTGGAATGGTATGCTGGCTACCCCCTCCTGCCACAGCCCCGCTGGCGATCTCGTACTGACCTTTTGT
GCCTTGCGCAGCGACTACATCAACCCGATCGATCTCTGCAACCGCCTGAACACGTACATCATTCCCGAAGCTGCCGTACA
TGGATTCCTGACTTTTCTCTTTCTAATCAACGGGTACTGGGTGCCGCTGGTTCTGAACGTCCCCCTGCTGGCGTGGAACG
TCAAGAAGTATGATCCCTGTTCTTCGTGGCGATAGGTACGCGAGGTACAGCTTGCTAACTCGGTGGCTGCAGGATCGTCG
ACAACACGCACCTGCTAGATGCAACGGAAATCTTCCGGAAACTGAACGTCCACAAGAAGGTCAGTCACGGGCTCGTGCTA
TCGTCTTTCCCTCTATAACGGCCGGCTGACACCCATGTACAGGAGTCCTTCATGAAGCTTGGCTTCCATCTGATCATGTT
CTTCTTCTACCTCTACAGCATGATTGTGGCTCTTATTAAGGACGACGCCAACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62