GenePrediction:GLEAN_389 Details

Name: GLEAN_389
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1477048..1479132 (+ strand)
Length: 2085
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1477048..1477058 (+ strand)
Length: 11
Type: CDS
Source: GLEAN
Position: GCSC_167:1477236..1478013 (+ strand)
Length: 778
Type: CDS
Source: GLEAN
Position: GCSC_167:1478077..1479132 (+ strand)
Length: 1056
>GLEAN_389 class=GenePrediction position=GCSC_167:1477048..1479132 (+ strand)
ATGGGTCTCCCGTAAGTATCAAGTTTCGGTTTTCTTGCTGCGCTGTCCGGGTTGCTCTTTACTTTGTGGTTGATCACCCG
ATAAGCCGGTGCCACTCGTCAACTCTTCTCTCGTTGCACCCAGAGGAGGTAGGCTCCAATTTTCGAGCACCTGTATCGGT
CTCTTTGCTGACCGCGCTGGCTCTTTAGACTGTACGTTGCTCCGACCGAGGCCCAGCGGCGCCACAAAGCCAATTGTCGC
CCTGCTTCGCCTCATGTCAACTCCTCCATCCTCCGCGCATACCGGCAATCCCCAAACACGTTGCGCGAGAGTCGCCGACG
TCGCGTCTTGGCTACGGTGGCAGCTCATAACCTCAGTCAGTTTGAGCGACAACGCGAGCAGGATGAGGCTCACGAGCAAG
AACGACGCCGCGAGCAGGGAATCATCGGTCTCCCCAACTGGCCTCCGGCAGACGCTGGGGAGCAGATCCTCCAGCAGTTC
CTAGAACGCGCTCGACAGCCGGAGTTGACGCGAACACCTGGCACGCATATTAGTAGCAGCAGTGAAGTCCCTCCCAGATG
GAGGCCTTCTTTTTTGTCAGAAGACGCATTGGGGGCGGCAGAACCGGAGGGTAACGCCGCTCGATCGCCTCGATCGCTTC
CTCCCCCTCGTAACCATAGGCCCGCGAGTGACGATACTGTCTCGCCCAGCGACCTGTGGGGACCTCAGACCCAGGCAGCC
TTTGGACAGGGACCCTCGAGTCCTTCCAACATACTATACGATATTTATCACAGTGCTACCGGCGCGAACGACGGCAATCT
TGCCAGCTCTCGCTCGTATGGTCTTGATGGACAGGTGGATCACGCGTTTGACGACTTCCTTGGCGAAAGCAACGGCGACA
ACGGCGGGAACCTCGAATCGATTGGTCGTCGGCAGACGTTTAGCAGCCGCCTTATACGACACACCTCTTCTCTACGACGC
TCACATGTGAGGAAATTATTTTCTCTGTTCTGACGGCAGTCGCAGCCCCATTTGCTAAAACCAAAACAGGAGTCTGCCCC
AACGAGACGCTCTGTAGTGGGCTGGTCCGACCACGATCCGATAGGCCGACTACGCAGATCGTCTCCGGCGCGAAACTCTG
CACGTGCCAATGCAAGCAACGGCAATGGGGATGCCGGCAACATTGATGGACACCAGGACAACAGCAGCAGCGCTGCCGCC
AATCGCCGACGTGCCTGGGAAATACGATACTACGAGCCGCACCCGTTGCCGTCGATCCGGACGATTCTGGGCAACCAGGT
TGACGGGCTTGGCGACCGCAGCCGGAGCCTTAGCCCTGAAGGCGATGGTGCTTGGGATACACTGCTGACGACGCTAACGC
CCGACCCCCAACCGCCGAGCTTAGGTTCGTCGTTTGCCTCTACCACTGCGCCGGCACCAGCTGCAAGGACATCGTCGGCA
TCTCCAACAAATGGAGCGAGAACGGGCCCGCCTGCAATTTTTCCAAGAGAGCCCGTCCCAGCCGTGGTGTCGCCGCCTGC
AGGTAGCTTCACATCTGGCGATTTGTCTAGCACGTCGGCCAACACGTCGCAAAGAGTCCGGTCTCCTTTTACCGTCGTGT
CGGCATCGACCGATACGGCGGACGAATCTACCATTTTGCCCGAAACGACCGGACTGGACGGAGACCTGGCTTTCGCGCCA
GACGTGGGTCAAGAGCCAGGATGCGAAGACTCGGAAATGGATGGCGAAGACCAGTACTTGGATATGACTCGGAATCATAG
AACTCTCTTTTTCAATGGAAGGGGCGAATCGCAGCCTTGGGAGACGCGTGCCTTCGTGTCCTTTGCGGGCGGCCACGATA
TAGGCAACAGCAGTGGAGGCGATACAGGCAACATCAGCCGTGACCACAGCCACAGCCGTAGCCGTGGCCGTGGCCTCGCC
AACGGCAACAATAGCAGCAACAATGGCGATGAATTGCTGGAGCGTCTTGGCATCAGCGGGATGCTGAACATTGTACGTAA
TCTGGCACGACGGGAAGACATCCCCGACGAGCTTTGGGCTGAAGCTGGACTCAGCCGGACACTTGGTCGGGGGACATCCA
GCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62