GenePrediction:GLEAN_38 Details

Name: GLEAN_38
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:280950..281915 (+ strand)
Length: 966
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:280950..281031 (+ strand)
Length: 82
Type: CDS
Source: GLEAN
Position: GCSC_179:281134..281229 (+ strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_179:281306..281499 (+ strand)
Length: 194
Type: CDS
Source: GLEAN
Position: GCSC_179:281547..281915 (+ strand)
Length: 369
>GLEAN_38 class=GenePrediction position=GCSC_179:280950..281915 (+ strand)
ATGTCTAGGAGGTCCACCACGTCGGCGGCCAACGGCGCCGTCGATGCGGTCACCGGCGGTGCGTCACCATATAGCCAGCC
GGGTAGGTCTGGACTCGTTTGCCTCCCATGTGCCAAGGGAGGCTGCTTCGCGTGTGTCTGTTTTTTTTTTTAGTTTTTTG
TCTTTGCTGACCGGTCTCGCGCAGCCTACGACAAGCAGAAGCTCCTGCTGTCGAGCGATCCCGGGCACTTCTCGCTCATC
CGCGCGCTGCACATGGCCGATTTTATCACGGAGCTGAATGGTGAGTGAAGAGTGACGGACACGGAGGACAGGCGGCCAAT
TGGGAAAAGGGGAGTGGCTGGACTGACGCTTGCCAGGGATGTGCGGGGTGCTGTCGATTTTCTCGTCGCTGCGGTACTGC
ATCGACCCGTCAGCCGGCAACGGCAATCTCTGGGCGGCTCTCGGGTTCCTGCCGCTGGGGCTGTTCTTTGACTTTCTGGA
CGGCAAGGTGGCGCGGTGGCGCAAGAAGAGCAGCATGATGGGCCAGGAGCTGGACTCGCTGGCGGATCTGGTATGTTCTC
TGGGCCCTTTTTCATCTTGCCTTGTCCTGACGTCTAGATCTCGTTTGGCGTCGCGCCCGCTTCGGTGGCCTTTACGATCG
GCTTCCAGACCGCACTCGACCACGTGGCGCTGGCGTTCTTTGTGCTCTGCGGGCTCACGCGGCTGGCGCGCTTCAACGTG
ACGACGCAGGTGATTCCCAAGGACAAGTCGGGCAAGGCGGCGTACTTTGAGGGCACGCCGATCCCGACCAGTCTCGGGCT
GGACGCCCTGATGGCCTACTGGGTCTCGCAGGGCTGGACGCACGCGGCGCTGCCGTGGGGCACAGTGTTTGCCGGCACGG
CCTTGGAGCTGCACCCGGCCGTCCTGCTCTTCGTCCTGCACGGCTGCATGATGACGAGCAAGACGATCCACATACCGAAG
CCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62