GenePrediction:GLEAN_3900 Details

Name: GLEAN_3900
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1562411..1563079 (+ strand)
Length: 669
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1562411..1562457 (+ strand)
Length: 47
Type: CDS
Source: GLEAN
Position: GCSC_113:1562515..1563079 (+ strand)
Length: 565
>GLEAN_3900 class=GenePrediction position=GCSC_113:1562411..1563079 (+ strand)
ATGCCGCTCTCCGACCAGTCGACTCCATCGTCGTTTGACGAGAACGAGTAAGCGGATGTCATGGCTCTACTTCTCCACAG
TGACGCTGACTCCTGACTTTCCAGAGACTTTTACAACGGAAATGGCCTCTCCAAGATCACCCGCAAGCTCAAGCAGGAGC
CGCTGATCCCGCTCGGCTGCCTGCTGACCGTGGCCGCTTTCACCAACGCCTACCGCGCCATGCGCCGCGGTGACCACAAC
CAGGTCCAGCGCATGTTCCGTGCCCGCATCATCGCCCAGGGCTTCACTGTCGCCGCCATGGTCGCTGGTGGCATCTATTT
TGGCGCTGAGCGCCACAAGGAGCGCGAGCTCTGGAAGGTCCAGCAGTCCCAGAAGGAGGAGGAGAAGCGTCAGCGCTGGA
TCGGCGAGCTCGAGGCCCGCGACGCCGAGGAGAAGCTTCTGCAGGAGCGCCTCGCCCGGAAGCGCAGCCGGAAGGCAGGT
GGTGACGCCAGCGAAGAAGTTTCCACAACAGAAGCACCACCCAGTCCCATCCTTGCTGCTGCTGCCGCAGTCGCAGACAC
CCCCGAGAAGCTCAAGGCCAACGACAAGAGCGCTCTCGGCACTCTGGGCAGCCTCTTTTCCAAAAATCCCACCGTGGCCG
CCAAGGTCGACGAGGCGGACAAGAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62