GenePrediction:GLEAN_3903 Details

Name: GLEAN_3903
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1582826..1586549 (+ strand)
Length: 3724
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1582826..1584270 (+ strand)
Length: 1445
Type: CDS
Source: GLEAN
Position: GCSC_113:1584326..1586549 (+ strand)
Length: 2224
>GLEAN_3903 class=GenePrediction position=GCSC_113:1582826..1586549 (+ strand)
ATGTCCGCGCTGCAGCACCCGGTGGATGCCGTTGACAGACGACCGGTAACGGGCCCGGAGAGCAAAAACTCTCCGTTGAC
CGTTGGACCGGGTGCCGGTACTGTGCCGCTGTCAGCTGCTCCCGGTGTGACCGACCTGGACGGGATGATCCTGGATGTGG
ACCTTGACACCACCGCCGTCCATGCCAAACATGCTTCTGTAGCTGCTAGCACCAGTGCTGCTGTTGGTCTTGGCCCGGTC
CAAAAGAGTCGTGTTGGCTCTGACATAAGGCCAGCTGCCACAACAAACATCCCTGACCTATCATTTAGCGGCTATAAAGT
TTTACGAGAGGATGACAACAGCCTAGATCTGTTTGGGACACGCTCTTCTCTACCTTCTCCTTCCCAAACCGACGCCGATT
GCGATTGCAGTGGTGCCGGCATTGATTCCAAAGGAGTGCCAACTGTCTTGCCCGATGCAAAGACAGTCAAGAATGAAGCT
AAATCGGATGGGATGATTGCCTCTACGCTCAACTCATCGAAACTTTCAGCAACAGGTTCTCTACCGCTCCTAGGGGAGGC
TGACCGCCTAAGACGAGCGAGCATCGGGGCAGCCGCTTCTGAGGTCGGTAGCCAGGACAGCAACGGTCAGGACGGACCCA
ATTCGCTCTTCGACGAGCCCATGTCCGACGAGTTCGGGCTGGTTGTGAATGGGCCCATAGACAGCATTGACCTGGGCGGC
AGCTCTACCGCCTCCCGACAGCCTCTGTTCGCCAAAGACGACAAGCTGAGCGACATTACGCCAGCATGGAGCGAGCTGAA
GACCAAGGCGGGAAAAGAGCGCAAACGCCTGCCGCTGGCTTGCATTGCCTGTCGCCGGAAGAAGATCCGATGCTCGGGCG
AGAAGCCGGCATGCAAGCACTGCCTGCGATCGCGCACCCCCTGCGTGTACAAGGTCACCACCCGCAAGGCAACGCCGCGT
ACCGACTACATGGCCATGCTCGATAAGCGGCTCAAGCGCATGGAGGACCGTATCATCAAGATTGTCCCCAAGACAGAGCA
GGATGCTGTCGCCATGTCTTCTTCCGTCGTTCGGGCCATTGTCAAGCCGGCCATTCCCGGGGTCTCGGCATCTGCCACTG
CCAGCAGAAATGGAAATGGAAATGGTTCTGGCAGTGCCGCTGCAGGAGTCAAGTCAGCTACAAAGAAGCGGCTGGCTGAT
GAGGCTTTTGGCACTGAACTCGACCATTGGGCGCGCGCCAGTTCCAAGGGCCGTCCGGCCGATGCTTTGCGGCCACACAA
CCTTCTCCTGCAGCAAGAGTCTGAAGAAAACAAGCTGCTGCGAGAAGGCGCTGATGCGCTGCCGTCCCATGAGCTTCAGG
ACCACCTGGCCGAGGTGTACTTTGAGAACATCTACGGCCAGGCTTATCATCTCCTGCACAAGCCAAGCTATATGAGGAAG
CTGAAGTAGGTTGCATCCCGTCAGTACGTCTACCATTTCAGACCCGAACTGACCAAACAGGGCCGGAACACTGCCGCCTG
TCCTGATACTTTCCGTTTGCGCCGTATCTGCTCGATTTTCCTCGCACCCGAAGCTTGAAAGCGGTCCCAACTTCCTGCGT
GGCGAAGAATGGGCATCGCACGCCCGTGATATTGTCATGCGGCGGTACGAGTGGCCAAACATAACGATTCTGACCTGCCT
CCTCCTCCTCGGACTCCACGAGTTTGGCACCTGCCATGGTGGCCGCAGCTGGGCGCTCGGCGGTCAGGCCATCCGCATGG
CCTTTGCACTGCAGCTGCACAAGGACGTCGAGCAGGATCCGCAGCTCATCACCGGGGCTGCTCCCCTCAGCTTCACCGAC
CGTGAGATCCGATGCCGCACGATGTGGGCCTGTTTCCTGATGGACCGTTTCAACTCGTCTGGCACGGAACGGCCGACGTT
TGTCCGAGAGGAAACGATCAAGATCCAGTTGCCGGTGTCGGAGAAGCACTTTCATCTCGACATGCCGGGAGTGACGGAGA
GCCTAGCTGGTCATCCGGTAACTCCACCGTTAGCTGCGGCTGCCAGGGACGACGACGACCTGGCCCCCAACGCAAAGGAA
AACATGGGAGTTGCGGCCTACATGATTCGGTCCATCGCTGTTTGGGGGCGGGTCATCAACTACCTCAACCAGGGAGGCAA
GGAGCTCGATCCTCAGCCTATGTGGAGCGTCGATTCGGAATACCACAAGCTGGCTATTCAAGCCGACGAAATGCTTTCGA
CGTTGCCACCGGCGCTCGCCTTTTCCAGCGAGAACCTCCACGTGCACGACACAGACAAGATGGCCAACCAGTTCTTGTTC
TTGCATATTGCGATTCAGCAAAACATTCTGTTCCTAAACCGCTTTGCCGTGTCGTCACCCAACAGCATTTCACAGCAGGA
CATACCCAAGACGTTTGTTACCAAGGCAGGCGCCAAGGCGTTTGCGGCGGCGAACCGCATATCCGAGCTCCTGAAGGAGG
CCGAGTCCTACATGGTTTCGGCGCCCTTTGTCGGCTACTGTGCCTTTCTGTCCAGCACGGTACATATCTTTGGCATTTTC
TCGGGCAATTCGACGATGGAAGCGACGTCGAAACGTAACCTTGCAACGAATGTCAAGTTTCTGTCCAAGATGAAGCGGTA
TTGGGGCATGTTTCATTTCATGGCAGAGAACTTGCGTGAGCAGTACCGCACGTGTGCCGATGCCGCGCGCCAGGGTACTC
CGGCCCACGAGAACGCGGCGGTGGCGTCGCCGATTTTCCAGTACGGCGACTGGTTTGACCGCTATCCGTATGGTGTGTCG
AACTCCGACTTTGTCGACCCGGCGGCGTATCTGAAGAAGGAGAAGGGAGACGATGCGGTGCTGGAGCAGAAACCAGAGCT
GCACACGGTCGAGCAGTTTTTCACAAACGTTGGGGCCCCCAACACAGATGGATCTGTTTCCGGCAGCACTACTGCAAATC
AAACGACGACGACTGGCAGAAGTGGCGGACACAACAAGCGAAAGTCGTGTTCGCGGAAGGGGGGCGGCTCGATTTCGTCC
AGGAGTACGGACCATCAAACTTTGATGGCGGACATGCATTCGTCAGGCACAGATGTGCTTCACCGACAGCGGCAGCAGCA
AAATGCGCAGGTGCATAACATCAACCGGCAGGCCAGCCACACATCGATGACTGGCCAGACAAGTGGCGCAGCAGCTGGCT
TCATTCCCATGACCATGCCACAGGCCGGTGTCGGCTCATCGTTTATGCCGCCGCTTAGCCCGATCACGATGAGCTCATTC
TCGCACCAACAGCAGCAGCTGGCGCAGCTCTACCCATCCGATCTGCTGCCACTCTCTCTGGTGCAGCAGACCAACAGCAT
GATGCCGGAACTGGATCGGCAGCTTGTCTTTGGTGCTTATGGGAATCTCGACCAGGCTGGCGGGGGGATCGGGGATCAGG
CCTCAATAGACGGCTTAGACTGGAATGGATCTGGGAGTGCGGACCAGAGCACCGCACAAGCAGCAGCGAACGGCGAATCT
GGCAACGGGCCGACAGATGGCCTAGACGCTTTGGGGCATAGTCATGACGTTTCATCAGCCTGGTTCATGCCCTTCAACAT
GGACCCACCCGAGCTCGGCCAGGAGTTTGGCGGCATGGCCGGCAGTCTTGACCATCTTGCCAGTATTTTTGGGAGCAGTG
TGATGGCCTCTCAGAGTGGTGGCGGTGGGCTCCACCATGATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62